]> git.donarmstrong.com Git - biopieces.git/commitdiff
added tests for remove_keys
authormartinahansen <martinahansen@74ccb610-7750-0410-82ae-013aeee3265d>
Wed, 8 Jun 2011 14:25:07 +0000 (14:25 +0000)
committermartinahansen <martinahansen@74ccb610-7750-0410-82ae-013aeee3265d>
Wed, 8 Jun 2011 14:25:07 +0000 (14:25 +0000)
git-svn-id: http://biopieces.googlecode.com/svn/trunk@1467 74ccb610-7750-0410-82ae-013aeee3265d

bp_test/in/remove_keys.in [new file with mode: 0644]
bp_test/out/remove_keys.out.1 [new file with mode: 0644]
bp_test/test/test_remove_keys [new file with mode: 0755]

diff --git a/bp_test/in/remove_keys.in b/bp_test/in/remove_keys.in
new file mode 100644 (file)
index 0000000..2b130d5
--- /dev/null
@@ -0,0 +1,4 @@
+SEQ_NAME: test
+SEQ: CAGCACTAGCATCGACGACAGCACGCAT
+SEQ_LEN: 28
+---
diff --git a/bp_test/out/remove_keys.out.1 b/bp_test/out/remove_keys.out.1
new file mode 100644 (file)
index 0000000..50a3ce6
--- /dev/null
@@ -0,0 +1,2 @@
+SEQ_LEN: 28
+---
diff --git a/bp_test/test/test_remove_keys b/bp_test/test/test_remove_keys
new file mode 100755 (executable)
index 0000000..e617c39
--- /dev/null
@@ -0,0 +1,7 @@
+#!/bin/bash
+
+source "$BP_DIR/bp_test/lib/test.sh"
+
+run "$bp -I $in -k SEQ_NAME,SEQ -O $tmp"
+assert_no_diff $tmp $out.1
+clean