5 * Created by Pat Schloss on 12/22/10.
6 * Copyright 2010 Schloss Lab. All rights reserved.
10 #include "trimflowscommand.h"
11 #include "needlemanoverlap.hpp"
14 //**********************************************************************************************************************
15 vector<string> TrimFlowsCommand::setParameters(){
17 CommandParameter pflow("flow", "InputTypes", "", "", "none", "none", "none","flow-file",false,true,true); parameters.push_back(pflow);
18 CommandParameter poligos("oligos", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(poligos);
19 CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop);
20 CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows);
21 CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows);
22 CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(ppdiffs);
23 CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(pbdiffs);
24 CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pldiffs);
25 CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(psdiffs);
26 CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(ptdiffs);
27 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
28 CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal);
29 CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise);
30 CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles);
31 CommandParameter porder("order", "Multiple", "A-B", "A", "", "", "","",false,false, true); parameters.push_back(porder);
32 CommandParameter pfasta("fasta", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pfasta);
33 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
34 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
36 vector<string> myArray;
37 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
41 m->errorOut(e, "TrimFlowsCommand", "setParameters");
45 //**********************************************************************************************************************
46 string TrimFlowsCommand::getHelpString(){
48 string helpString = "";
49 helpString += "The trim.flows command reads a flowgram file and creates .....\n";
50 helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFasta).\n";
51 helpString += "For more details please check out the wiki http://www.mothur.org/wiki/Trim.flows.\n";
55 m->errorOut(e, "TrimFlowsCommand", "getHelpString");
59 //**********************************************************************************************************************
60 string TrimFlowsCommand::getOutputPattern(string type) {
64 if (type == "flow") { pattern = "[filename],[tag],flow"; }
65 else if (type == "fasta") { pattern = "[filename],flow.fasta"; }
66 else if (type == "file") { pattern = "[filename],flow.files"; }
67 else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
72 m->errorOut(e, "TrimFlowsCommand", "getOutputPattern");
76 //**********************************************************************************************************************
78 TrimFlowsCommand::TrimFlowsCommand(){
80 abort = true; calledHelp = true;
82 vector<string> tempOutNames;
83 outputTypes["flow"] = tempOutNames;
84 outputTypes["fasta"] = tempOutNames;
85 outputTypes["file"] = tempOutNames;
88 m->errorOut(e, "TrimFlowsCommand", "TrimFlowsCommand");
92 //**********************************************************************************************************************
94 TrimFlowsCommand::TrimFlowsCommand(string option) {
97 abort = false; calledHelp = false;
100 //allow user to run help
101 if(option == "help") { help(); abort = true; calledHelp = true; }
102 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
106 vector<string> myArray = setParameters();
108 OptionParser parser(option);
109 map<string,string> parameters = parser.getParameters();
111 ValidParameters validParameter;
112 map<string,string>::iterator it;
114 //check to make sure all parameters are valid for command
115 for (it = parameters.begin(); it != parameters.end(); it++) {
116 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
119 //initialize outputTypes
120 vector<string> tempOutNames;
121 outputTypes["flow"] = tempOutNames;
122 outputTypes["fasta"] = tempOutNames;
123 outputTypes["file"] = tempOutNames;
125 //if the user changes the input directory command factory will send this info to us in the output parameter
126 string inputDir = validParameter.validFile(parameters, "inputdir", false);
127 if (inputDir == "not found"){ inputDir = ""; }
130 it = parameters.find("flow");
131 //user has given a template file
132 if(it != parameters.end()){
133 path = m->hasPath(it->second);
134 //if the user has not given a path then, add inputdir. else leave path alone.
135 if (path == "") { parameters["flow"] = inputDir + it->second; }
138 it = parameters.find("oligos");
139 //user has given a template file
140 if(it != parameters.end()){
141 path = m->hasPath(it->second);
142 //if the user has not given a path then, add inputdir. else leave path alone.
143 if (path == "") { parameters["oligos"] = inputDir + it->second; }
149 //check for required parameters
150 flowFileName = validParameter.validFile(parameters, "flow", true);
151 if (flowFileName == "not found") {
152 flowFileName = m->getFlowFile();
153 if (flowFileName != "") { m->mothurOut("Using " + flowFileName + " as input file for the flow parameter."); m->mothurOutEndLine(); }
155 m->mothurOut("No valid current flow file. You must provide a flow file."); m->mothurOutEndLine();
158 }else if (flowFileName == "not open") { flowFileName = ""; abort = true; }
160 //if the user changes the output directory command factory will send this info to us in the output parameter
161 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){
163 outputDir += m->hasPath(flowFileName); //if user entered a file with a path then preserve it
167 //check for optional parameter and set defaults
168 // ...at some point should added some additional type checking...
171 temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; }
172 m->mothurConvert(temp, minFlows);
174 temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; }
175 m->mothurConvert(temp, maxFlows);
178 temp = validParameter.validFile(parameters, "oligos", true);
179 if (temp == "not found") { oligoFileName = ""; }
180 else if(temp == "not open") { abort = true; }
181 else { oligoFileName = temp; m->setOligosFile(oligoFileName); }
183 temp = validParameter.validFile(parameters, "fasta", false); if (temp == "not found"){ fasta = 0; }
184 else if(m->isTrue(temp)) { fasta = 1; }
186 temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; }
187 m->mothurConvert(temp, maxHomoP);
189 temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; }
190 m->mothurConvert(temp, signal);
192 temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; }
193 m->mothurConvert(temp, noise);
195 temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; }
196 m->mothurConvert(temp, bdiffs);
198 temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; }
199 m->mothurConvert(temp, pdiffs);
201 temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; }
202 m->mothurConvert(temp, ldiffs);
204 temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; }
205 m->mothurConvert(temp, sdiffs);
207 temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); }
208 m->mothurConvert(temp, tdiffs);
210 if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; }
213 temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
214 m->setProcessors(temp);
215 m->mothurConvert(temp, processors);
217 temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
218 if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A or B. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC.\n"); abort=true;
221 if (toupper(temp[0]) == 'A') { flowOrder = "TACG"; }
222 else if(toupper(temp[0]) == 'B'){
223 flowOrder = "TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC"; }
225 m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A or B. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC.\n"); abort=true;
229 if(oligoFileName == "") { allFiles = 0; }
230 else { allFiles = 1; }
238 catch(exception& e) {
239 m->errorOut(e, "TrimFlowsCommand", "TrimFlowsCommand");
244 //***************************************************************************************************************
246 int TrimFlowsCommand::execute(){
249 if (abort == true) { if (calledHelp) { return 0; } return 2; }
251 map<string, string> variables;
252 variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
253 string fastaFileName = getOutputFileName("fasta",variables);
254 if(fasta){ outputNames.push_back(fastaFileName); outputTypes["fasta"].push_back(fastaFileName); }
256 variables["[tag]"] = "trim";
257 string trimFlowFileName = getOutputFileName("flow",variables);
258 outputNames.push_back(trimFlowFileName); outputTypes["flow"].push_back(trimFlowFileName);
260 variables["[tag]"] = "scrap";
261 string scrapFlowFileName = getOutputFileName("flow",variables);
262 outputNames.push_back(scrapFlowFileName); outputTypes["flow"].push_back(scrapFlowFileName);
266 vector<unsigned long long> flowFilePos;
267 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
268 flowFilePos = getFlowFileBreaks();
269 for (int i = 0; i < (flowFilePos.size()-1); i++) {
270 lines.push_back(new linePair(flowFilePos[i], flowFilePos[(i+1)]));
273 ifstream in; m->openInputFile(flowFileName, in); in >> numFlows; in.close();
274 ///////////////////////////////////////// until I fix multiple processors for windows //////////////////
276 ///////////////////////////////////////// until I fix multiple processors for windows //////////////////
277 if (processors == 1) {
278 lines.push_back(new linePair(0, 1000));
281 flowFilePos = m->setFilePosEachLine(flowFileName, numFlowLines);
282 flowFilePos.erase(flowFilePos.begin() + 1); numFlowLines--;
284 //figure out how many sequences you have to process
285 int numSeqsPerProcessor = numFlowLines / processors;
286 cout << numSeqsPerProcessor << '\t' << numFlowLines << endl;
287 for (int i = 0; i < processors; i++) {
288 int startIndex = i * numSeqsPerProcessor;
289 if(i == (processors - 1)){ numSeqsPerProcessor = numFlowLines - i * numSeqsPerProcessor; }
290 lines.push_back(new linePair(flowFilePos[startIndex], numSeqsPerProcessor));
291 cout << flowFilePos[startIndex] << '\t' << numSeqsPerProcessor << endl;
296 vector<vector<string> > barcodePrimerComboFileNames;
297 if(oligoFileName != ""){
298 getOligos(barcodePrimerComboFileNames);
302 driverCreateTrim(flowFileName, trimFlowFileName, scrapFlowFileName, fastaFileName, barcodePrimerComboFileNames, lines[0]);
304 createProcessesCreateTrim(flowFileName, trimFlowFileName, scrapFlowFileName, fastaFileName, barcodePrimerComboFileNames);
307 if (m->control_pressed) { return 0; }
309 string flowFilesFileName;
313 set<string> namesAlreadyProcessed;
314 flowFilesFileName = getOutputFileName("file",variables);
315 m->openOutputFile(flowFilesFileName, output);
317 for(int i=0;i<barcodePrimerComboFileNames.size();i++){
318 for(int j=0;j<barcodePrimerComboFileNames[0].size();j++){
319 if (namesAlreadyProcessed.count(barcodePrimerComboFileNames[i][j]) == 0) {
320 if (barcodePrimerComboFileNames[i][j] != "") {
322 unsigned long long size;
324 //get num bytes in file
325 pFile = fopen (barcodePrimerComboFileNames[i][j].c_str(),"rb");
326 if (pFile==NULL) perror ("Error opening file");
328 fseek (pFile, 0, SEEK_END);
334 m->mothurRemove(barcodePrimerComboFileNames[i][j]);
337 output << m->getFullPathName(barcodePrimerComboFileNames[i][j]) << endl;
338 outputNames.push_back(barcodePrimerComboFileNames[i][j]);
339 outputTypes["flow"].push_back(barcodePrimerComboFileNames[i][j]);
341 namesAlreadyProcessed.insert(barcodePrimerComboFileNames[i][j]);
349 flowFilesFileName = getOutputFileName("file",variables);
350 m->openOutputFile(flowFilesFileName, output);
352 output << m->getFullPathName(trimFlowFileName) << endl;
356 outputTypes["file"].push_back(flowFilesFileName);
357 outputNames.push_back(flowFilesFileName);
359 m->mothurOutEndLine();
360 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
361 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
362 m->mothurOutEndLine();
366 catch(exception& e) {
367 m->errorOut(e, "TrimSeqsCommand", "execute");
372 //***************************************************************************************************************
374 int TrimFlowsCommand::driverCreateTrim(string flowFileName, string trimFlowFileName, string scrapFlowFileName, string fastaFileName, vector<vector<string> > thisBarcodePrimerComboFileNames, linePair* line){
377 ofstream trimFlowFile;
378 m->openOutputFile(trimFlowFileName, trimFlowFile);
379 trimFlowFile.setf(ios::fixed, ios::floatfield); trimFlowFile.setf(ios::showpoint);
381 ofstream scrapFlowFile;
382 m->openOutputFile(scrapFlowFileName, scrapFlowFile);
383 scrapFlowFile.setf(ios::fixed, ios::floatfield); scrapFlowFile.setf(ios::showpoint);
386 if(fasta){ m->openOutputFile(fastaFileName, fastaFile); }
389 m->openInputFile(flowFileName, flowFile);
391 flowFile.seekg(line->start);
393 if(line->start == 0){
394 flowFile >> numFlows; m->gobble(flowFile);
395 scrapFlowFile << maxFlows << endl;
396 trimFlowFile << maxFlows << endl;
398 for(int i=0;i<thisBarcodePrimerComboFileNames.size();i++){
399 for(int j=0;j<thisBarcodePrimerComboFileNames[0].size();j++){
400 if (thisBarcodePrimerComboFileNames[i][j] != "") {
402 m->openOutputFile(thisBarcodePrimerComboFileNames[i][j], temp);
403 temp << maxFlows << endl;
411 FlowData flowData(numFlows, signal, noise, maxHomoP, flowOrder);
412 //cout << " driver flowdata address " << &flowData << &flowFile << endl;
416 TrimOligos trimOligos(pdiffs, bdiffs, ldiffs, sdiffs, primers, barcodes, revPrimer, linker, spacer);
420 if (m->control_pressed) { break; }
423 int currentSeqDiffs = 0;
424 string trashCode = "";
426 flowData.getNext(flowFile);
427 flowData.capFlows(maxFlows);
429 Sequence currSeq = flowData.getSequence();
430 if(!flowData.hasMinFlows(minFlows)){ //screen to see if sequence is of a minimum number of flows
436 int barcodeIndex = 0;
439 success = trimOligos.stripLinker(currSeq);
440 if(success > ldiffs) { trashCode += 'k'; }
441 else{ currentSeqDiffs += success; }
445 if (m->debug) { m->mothurOut("[DEBUG]: " + currSeq.getName() + " " + currSeq.getUnaligned() + "\n"); }
447 if(barcodes.size() != 0){
448 success = trimOligos.stripBarcode(currSeq, barcodeIndex);
449 if(success > bdiffs) { trashCode += 'b'; }
450 else{ currentSeqDiffs += success; }
454 success = trimOligos.stripSpacer(currSeq);
455 if(success > sdiffs) { trashCode += 's'; }
456 else{ currentSeqDiffs += success; }
460 if(numFPrimers != 0){
461 success = trimOligos.stripForward(currSeq, primerIndex);
462 if(success > pdiffs) { trashCode += 'f'; }
463 else{ currentSeqDiffs += success; }
466 if (currentSeqDiffs > tdiffs) { trashCode += 't'; }
468 if(numRPrimers != 0){
469 success = trimOligos.stripReverse(currSeq);
470 if(!success) { trashCode += 'r'; }
473 if(trashCode.length() == 0){
474 string thisGroup = "";
475 if(barcodes.size() != 0){
476 thisGroup = barcodeNameVector[barcodeIndex];
477 if (primers.size() != 0) {
478 if (primerNameVector[primerIndex] != "") {
479 if(thisGroup != "") {
480 thisGroup += "." + primerNameVector[primerIndex];
482 thisGroup = primerNameVector[primerIndex];
488 int pos = thisGroup.find("ignore");
489 if (pos == string::npos) {
490 flowData.printFlows(trimFlowFile);
492 if(fasta) { currSeq.setAligned(currSeq.getUnaligned()); currSeq.printSequence(fastaFile); }
496 m->openOutputFileAppend(thisBarcodePrimerComboFileNames[barcodeIndex][primerIndex], output);
497 output.setf(ios::fixed, ios::floatfield); trimFlowFile.setf(ios::showpoint);
499 flowData.printFlows(output);
505 flowData.printFlows(scrapFlowFile, trashCode);
509 //cout << "driver" << '\t' << currSeq.getName() << endl;
511 if((count) % 10000 == 0){ m->mothurOut(toString(count)); m->mothurOutEndLine(); }
513 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
514 unsigned long long pos = flowFile.tellg();
516 if ((pos == -1) || (pos >= line->end)) { break; }
518 if (flowFile.eof()) { break; }
523 if((count) % 10000 != 0){ m->mothurOut(toString(count)); m->mothurOutEndLine(); }
525 trimFlowFile.close();
526 scrapFlowFile.close();
528 if(fasta){ fastaFile.close(); }
532 catch(exception& e) {
533 m->errorOut(e, "TrimSeqsCommand", "driverCreateTrim");
538 //***************************************************************************************************************
540 void TrimFlowsCommand::getOligos(vector<vector<string> >& outFlowFileNames){
543 m->openInputFile(oligoFileName, oligosFile);
545 string type, oligo, group;
548 int indexBarcode = 0;
550 while(!oligosFile.eof()){
552 oligosFile >> type; m->gobble(oligosFile); //get the first column value of the row - is it a comment or a feature we are interested in?
554 if(type[0] == '#'){ //igore the line because there's a comment
555 while (!oligosFile.eof()) { char c = oligosFile.get(); if (c == 10 || c == 13){ break; } } // get rest of line if there's any crap there
557 else{ //there's a feature we're interested in
559 for(int i=0;i<type.length();i++){ type[i] = toupper(type[i]); } //make type case insensitive
561 oligosFile >> oligo; //get the DNA sequence for the feature
563 for(int i=0;i<oligo.length();i++){ //make type case insensitive and change any U's to T's
564 oligo[i] = toupper(oligo[i]);
565 if(oligo[i] == 'U') { oligo[i] = 'T'; }
568 if(type == "FORWARD"){ //if the feature is a forward primer...
571 while (!oligosFile.eof()) { // get rest of line in case there is a primer name = will have the name of the primer
572 char c = oligosFile.get();
573 if (c == 10 || c == 13){ break; }
574 else if (c == 32 || c == 9){;} //space or tab
578 //have we seen this primer already?
579 map<string, int>::iterator itPrimer = primers.find(oligo);
580 if (itPrimer != primers.end()) { m->mothurOut("primer " + oligo + " is in your oligos file already."); m->mothurOutEndLine(); }
582 primers[oligo]=indexPrimer; indexPrimer++;
583 primerNameVector.push_back(group);
586 else if(type == "REVERSE"){
587 string oligoRC = reverseOligo(oligo);
588 revPrimer.push_back(oligoRC);
590 else if(type == "BARCODE"){
593 //check for repeat barcodes
594 map<string, int>::iterator itBar = barcodes.find(oligo);
595 if (itBar != barcodes.end()) { m->mothurOut("barcode " + oligo + " is in your oligos file already."); m->mothurOutEndLine(); }
597 barcodes[oligo]=indexBarcode; indexBarcode++;
598 barcodeNameVector.push_back(group);
599 }else if(type == "LINKER"){
600 linker.push_back(oligo);
601 }else if(type == "SPACER"){
602 spacer.push_back(oligo);
605 m->mothurOut(type + " is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring " + oligo + "."); m->mothurOutEndLine();
609 m->gobble(oligosFile);
613 if(barcodeNameVector.size() == 0 && primerNameVector[0] == ""){ allFiles = 0; }
615 //add in potential combos
616 if(barcodeNameVector.size() == 0){
618 barcodeNameVector.push_back("");
621 if(primerNameVector.size() == 0){
623 primerNameVector.push_back("");
627 outFlowFileNames.resize(barcodeNameVector.size());
628 for(int i=0;i<outFlowFileNames.size();i++){
629 outFlowFileNames[i].assign(primerNameVector.size(), "");
634 for(map<string, int>::iterator itBar = barcodes.begin();itBar != barcodes.end();itBar++){
635 for(map<string, int>::iterator itPrimer = primers.begin();itPrimer != primers.end(); itPrimer++){
637 string primerName = primerNameVector[itPrimer->second];
638 string barcodeName = barcodeNameVector[itBar->second];
640 if ((primerName == "ignore") || (barcodeName == "ignore")) { } //do nothing
642 string comboGroupName = "";
643 string fileName = "";
645 map<string, string> variables;
646 variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
648 if(primerName == ""){
649 comboGroupName = barcodeNameVector[itBar->second];
650 variables["[tag]"] = comboGroupName;
651 fileName = getOutputFileName("flow", variables);
654 if(barcodeName == ""){
655 comboGroupName = primerNameVector[itPrimer->second];
658 comboGroupName = barcodeNameVector[itBar->second] + "." + primerNameVector[itPrimer->second];
660 variables["[tag]"] = comboGroupName;
661 fileName = getOutputFileName("flow", variables);
664 outFlowFileNames[itBar->second][itPrimer->second] = fileName;
667 m->openOutputFile(fileName, temp);
674 numFPrimers = primers.size();
675 numRPrimers = revPrimer.size();
676 numLinkers = linker.size();
677 numSpacers = spacer.size();
680 catch(exception& e) {
681 m->errorOut(e, "TrimSeqsCommand", "getOligos");
685 //********************************************************************/
686 string TrimFlowsCommand::reverseOligo(string oligo){
690 for(int i=oligo.length()-1;i>=0;i--){
692 if(oligo[i] == 'A') { reverse += 'T'; }
693 else if(oligo[i] == 'T'){ reverse += 'A'; }
694 else if(oligo[i] == 'U'){ reverse += 'A'; }
696 else if(oligo[i] == 'G'){ reverse += 'C'; }
697 else if(oligo[i] == 'C'){ reverse += 'G'; }
699 else if(oligo[i] == 'R'){ reverse += 'Y'; }
700 else if(oligo[i] == 'Y'){ reverse += 'R'; }
702 else if(oligo[i] == 'M'){ reverse += 'K'; }
703 else if(oligo[i] == 'K'){ reverse += 'M'; }
705 else if(oligo[i] == 'W'){ reverse += 'W'; }
706 else if(oligo[i] == 'S'){ reverse += 'S'; }
708 else if(oligo[i] == 'B'){ reverse += 'V'; }
709 else if(oligo[i] == 'V'){ reverse += 'B'; }
711 else if(oligo[i] == 'D'){ reverse += 'H'; }
712 else if(oligo[i] == 'H'){ reverse += 'D'; }
714 else { reverse += 'N'; }
720 catch(exception& e) {
721 m->errorOut(e, "TrimFlowsCommand", "reverseOligo");
726 /**************************************************************************************************/
727 vector<unsigned long long> TrimFlowsCommand::getFlowFileBreaks() {
731 vector<unsigned long long> filePos;
732 filePos.push_back(0);
735 unsigned long long size;
737 //get num bytes in file
738 pFile = fopen (flowFileName.c_str(),"rb");
739 if (pFile==NULL) perror ("Error opening file");
741 fseek (pFile, 0, SEEK_END);
746 //estimate file breaks
747 unsigned long long chunkSize = 0;
748 chunkSize = size / processors;
750 //file too small to divide by processors
751 if (chunkSize == 0) { processors = 1; filePos.push_back(size); return filePos; }
753 //for each process seekg to closest file break and search for next '>' char. make that the filebreak
754 for (int i = 0; i < processors; i++) {
755 unsigned long long spot = (i+1) * chunkSize;
758 m->openInputFile(flowFileName, in);
761 string dummy = m->getline(in);
763 //there was not another sequence before the end of the file
764 unsigned long long sanityPos = in.tellg();
766 // if (sanityPos == -1) { break; }
767 // else { filePos.push_back(newSpot); }
768 if (sanityPos == -1) { break; }
769 else { filePos.push_back(sanityPos); }
775 filePos.push_back(size);
777 //sanity check filePos
778 for (int i = 0; i < (filePos.size()-1); i++) {
779 if (filePos[(i+1)] <= filePos[i]) { filePos.erase(filePos.begin()+(i+1)); i--; }
783 m->openInputFile(flowFileName, in);
786 //unsigned long long spot = in.tellg();
790 processors = (filePos.size() - 1);
794 catch(exception& e) {
795 m->errorOut(e, "TrimSeqsCommand", "getFlowFileBreaks");
800 /**************************************************************************************************/
802 int TrimFlowsCommand::createProcessesCreateTrim(string flowFileName, string trimFlowFileName, string scrapFlowFileName, string fastaFileName, vector<vector<string> > barcodePrimerComboFileNames){
808 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
811 //loop through and create all the processes you want
812 while (process != processors) {
816 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
820 vector<vector<string> > tempBarcodePrimerComboFileNames = barcodePrimerComboFileNames;
822 for(int i=0;i<tempBarcodePrimerComboFileNames.size();i++){
823 for(int j=0;j<tempBarcodePrimerComboFileNames[0].size();j++){
824 if (tempBarcodePrimerComboFileNames[i][j] != "") {
825 tempBarcodePrimerComboFileNames[i][j] += toString(getpid()) + ".temp";
827 m->openOutputFile(tempBarcodePrimerComboFileNames[i][j], temp);
833 driverCreateTrim(flowFileName,
834 (trimFlowFileName + toString(getpid()) + ".temp"),
835 (scrapFlowFileName + toString(getpid()) + ".temp"),
836 (fastaFileName + toString(getpid()) + ".temp"),
837 tempBarcodePrimerComboFileNames, lines[process]);
841 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
842 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
849 m->openOutputFile(trimFlowFileName, temp);
852 m->openOutputFile(scrapFlowFileName, temp);
856 m->openOutputFile(fastaFileName, temp);
860 driverCreateTrim(flowFileName, trimFlowFileName, scrapFlowFileName, fastaFileName, barcodePrimerComboFileNames, lines[0]);
862 //force parent to wait until all the processes are done
863 for (int i=0;i<processIDS.size();i++) {
864 int temp = processIDS[i];
868 //////////////////////////////////////////////////////////////////////////////////////////////////////
869 //Windows version shared memory, so be careful when passing variables through the trimFlowData struct.
870 //Above fork() will clone, so memory is separate, but that's not the case with windows,
871 //////////////////////////////////////////////////////////////////////////////////////////////////////
873 vector<trimFlowData*> pDataArray;
874 DWORD dwThreadIdArray[processors-1];
875 HANDLE hThreadArray[processors-1];
877 //Create processor worker threads.
878 for( int i=0; i<processors-1; i++ ){
879 // Allocate memory for thread data.
880 string extension = "";
881 if (i != 0) { extension = toString(i) + ".temp"; processIDS.push_back(i); }
883 vector<vector<string> > tempBarcodePrimerComboFileNames = barcodePrimerComboFileNames;
885 for(int i=0;i<tempBarcodePrimerComboFileNames.size();i++){
886 for(int j=0;j<tempBarcodePrimerComboFileNames[0].size();j++){
887 if (tempBarcodePrimerComboFileNames[i][j] != "") {
888 tempBarcodePrimerComboFileNames[i][j] += extension;
890 m->openOutputFile(tempBarcodePrimerComboFileNames[i][j], temp);
897 trimFlowData* tempflow = new trimFlowData(flowFileName, (trimFlowFileName + extension), (scrapFlowFileName + extension), fastaFileName, flowOrder, tempBarcodePrimerComboFileNames, barcodes, primers, revPrimer, fasta, allFiles, lines[i]->start, lines[i]->end, m, signal, noise, numFlows, maxFlows, minFlows, maxHomoP, tdiffs, bdiffs, pdiffs, i);
898 pDataArray.push_back(tempflow);
900 //MyTrimFlowThreadFunction is in header. It must be global or static to work with the threads.
901 //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
902 hThreadArray[i] = CreateThread(NULL, 0, MyTrimFlowThreadFunction, pDataArray[i], 0, &dwThreadIdArray[i]);
905 //using the main process as a worker saves time and memory
907 m->openOutputFile(trimFlowFileName, temp);
910 m->openOutputFile(scrapFlowFileName, temp);
914 m->openOutputFile(fastaFileName, temp);
918 vector<vector<string> > tempBarcodePrimerComboFileNames = barcodePrimerComboFileNames;
920 for(int i=0;i<tempBarcodePrimerComboFileNames.size();i++){
921 for(int j=0;j<tempBarcodePrimerComboFileNames[0].size();j++){
922 if (tempBarcodePrimerComboFileNames[i][j] != "") {
923 tempBarcodePrimerComboFileNames[i][j] += toString(processors-1) + ".temp";
925 m->openOutputFile(tempBarcodePrimerComboFileNames[i][j], temp);
933 //do my part - do last piece because windows is looking for eof
934 int num = driverCreateTrim(flowFileName, (trimFlowFileName + toString(processors-1) + ".temp"), (scrapFlowFileName + toString(processors-1) + ".temp"), (fastaFileName + toString(processors-1) + ".temp"), tempBarcodePrimerComboFileNames, lines[processors-1]);
935 processIDS.push_back((processors-1));
937 //Wait until all threads have terminated.
938 WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
940 //Close all thread handles and free memory allocations.
941 for(int i=0; i < pDataArray.size(); i++){
942 num += pDataArray[i]->count;
943 CloseHandle(hThreadArray[i]);
944 delete pDataArray[i];
950 m->mothurOutEndLine();
951 for(int i=0;i<processIDS.size();i++){
953 m->mothurOut("Appending files from process " + toString(processIDS[i])); m->mothurOutEndLine();
955 m->appendFiles((trimFlowFileName + toString(processIDS[i]) + ".temp"), trimFlowFileName);
956 m->mothurRemove((trimFlowFileName + toString(processIDS[i]) + ".temp"));
957 // m->mothurOut("\tDone with trim.flow file"); m->mothurOutEndLine();
959 m->appendFiles((scrapFlowFileName + toString(processIDS[i]) + ".temp"), scrapFlowFileName);
960 m->mothurRemove((scrapFlowFileName + toString(processIDS[i]) + ".temp"));
961 // m->mothurOut("\tDone with scrap.flow file"); m->mothurOutEndLine();
964 m->appendFiles((fastaFileName + toString(processIDS[i]) + ".temp"), fastaFileName);
965 m->mothurRemove((fastaFileName + toString(processIDS[i]) + ".temp"));
966 // m->mothurOut("\tDone with flow.fasta file"); m->mothurOutEndLine();
969 for (int j = 0; j < barcodePrimerComboFileNames.size(); j++) {
970 for (int k = 0; k < barcodePrimerComboFileNames[0].size(); k++) {
971 if (barcodePrimerComboFileNames[j][k] != "") {
972 m->appendFiles((barcodePrimerComboFileNames[j][k] + toString(processIDS[i]) + ".temp"), barcodePrimerComboFileNames[j][k]);
973 m->mothurRemove((barcodePrimerComboFileNames[j][k] + toString(processIDS[i]) + ".temp"));
983 catch(exception& e) {
984 m->errorOut(e, "TrimFlowsCommand", "createProcessesCreateTrim");
989 //***************************************************************************************************************