5 * Created by Pat Schloss on 12/27/10.
6 * Copyright 2010 Schloss Lab. All rights reserved.
10 #include "shhhercommand.h"
12 //**********************************************************************************************************************
13 vector<string> ShhherCommand::setParameters(){
15 CommandParameter pflow("flow", "InputTypes", "", "", "none", "fileflow", "none","fasta-name-group-counts-qfile",false,false,true); parameters.push_back(pflow);
16 CommandParameter pfile("file", "InputTypes", "", "", "none", "fileflow", "none","fasta-name-group-counts-qfile",false,false,true); parameters.push_back(pfile);
17 CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup);
18 CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff);
19 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
20 CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter);
21 CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge);
22 CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma);
23 CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta);
24 CommandParameter porder("order", "Multiple", "A-B", "A", "", "", "","",false,false, true); parameters.push_back(porder); CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
25 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
27 vector<string> myArray;
28 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
32 m->errorOut(e, "ShhherCommand", "setParameters");
36 //**********************************************************************************************************************
37 string ShhherCommand::getHelpString(){
39 string helpString = "";
40 helpString += "The shhh.flows command reads a file containing flowgrams and creates a file of corrected sequences.\n";
41 helpString += "The shhh.flows command parameters are flow, file, lookup, cutoff, processors, large, maxiter, sigma, mindelta and order.\n";
42 helpString += "The flow parameter is used to input your flow file.\n";
43 helpString += "The file parameter is used to input the *flow.files file created by trim.flows.\n";
44 helpString += "The lookup parameter is used specify the lookup file you would like to use. http://www.mothur.org/wiki/Lookup_files.\n";
45 helpString += "The order parameter options are A or B. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC.\n";
49 m->errorOut(e, "ShhherCommand", "getHelpString");
53 //**********************************************************************************************************************
54 string ShhherCommand::getOutputPattern(string type) {
58 if (type == "fasta") { pattern = "[filename],shhh.fasta"; }
59 else if (type == "name") { pattern = "[filename],shhh.names"; }
60 else if (type == "group") { pattern = "[filename],shhh.groups"; }
61 else if (type == "counts") { pattern = "[filename],shhh.counts"; }
62 else if (type == "qfile") { pattern = "[filename],shhh.qual"; }
63 else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
68 m->errorOut(e, "ShhherCommand", "getOutputPattern");
72 //**********************************************************************************************************************
74 ShhherCommand::ShhherCommand(){
76 abort = true; calledHelp = true;
79 //initialize outputTypes
80 vector<string> tempOutNames;
81 outputTypes["fasta"] = tempOutNames;
82 outputTypes["name"] = tempOutNames;
83 outputTypes["group"] = tempOutNames;
84 outputTypes["counts"] = tempOutNames;
85 outputTypes["qfile"] = tempOutNames;
89 m->errorOut(e, "ShhherCommand", "ShhherCommand");
94 //**********************************************************************************************************************
96 ShhherCommand::ShhherCommand(string option) {
100 MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
101 MPI_Comm_size(MPI_COMM_WORLD, &ncpus);
105 abort = false; calledHelp = false;
107 //allow user to run help
108 if(option == "help") { help(); abort = true; calledHelp = true; }
109 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
112 vector<string> myArray = setParameters();
114 OptionParser parser(option);
115 map<string,string> parameters = parser.getParameters();
117 ValidParameters validParameter;
118 map<string,string>::iterator it;
120 //check to make sure all parameters are valid for command
121 for (it = parameters.begin(); it != parameters.end(); it++) {
122 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
125 //initialize outputTypes
126 vector<string> tempOutNames;
127 outputTypes["fasta"] = tempOutNames;
128 outputTypes["name"] = tempOutNames;
129 outputTypes["group"] = tempOutNames;
130 outputTypes["counts"] = tempOutNames;
131 outputTypes["qfile"] = tempOutNames;
134 //if the user changes the input directory command factory will send this info to us in the output parameter
135 string inputDir = validParameter.validFile(parameters, "inputdir", false);
136 if (inputDir == "not found"){ inputDir = ""; }
139 it = parameters.find("flow");
140 //user has given a template file
141 if(it != parameters.end()){
142 path = m->hasPath(it->second);
143 //if the user has not given a path then, add inputdir. else leave path alone.
144 if (path == "") { parameters["flow"] = inputDir + it->second; }
147 it = parameters.find("lookup");
148 //user has given a template file
149 if(it != parameters.end()){
150 path = m->hasPath(it->second);
151 //if the user has not given a path then, add inputdir. else leave path alone.
152 if (path == "") { parameters["lookup"] = inputDir + it->second; }
155 it = parameters.find("file");
156 //user has given a template file
157 if(it != parameters.end()){
158 path = m->hasPath(it->second);
159 //if the user has not given a path then, add inputdir. else leave path alone.
160 if (path == "") { parameters["file"] = inputDir + it->second; }
164 //if the user changes the output directory command factory will send this info to us in the output parameter
165 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
167 //check for required parameters
168 flowFileName = validParameter.validFile(parameters, "flow", true);
169 flowFilesFileName = validParameter.validFile(parameters, "file", true);
170 if (flowFileName == "not found" && flowFilesFileName == "not found") {
171 m->mothurOut("values for either flow or file must be provided for the shhh.flows command.");
172 m->mothurOutEndLine();
175 else if (flowFileName == "not open" || flowFilesFileName == "not open") { abort = true; }
177 if(flowFileName != "not found"){
178 compositeFASTAFileName = "";
179 compositeNamesFileName = "";
184 string thisoutputDir = outputDir;
185 if (outputDir == "") { thisoutputDir = m->hasPath(flowFilesFileName); } //if user entered a file with a path then preserve it
187 //we want to rip off .files, and also .flow if its there
188 string fileroot = m->getRootName(m->getSimpleName(flowFilesFileName));
189 if (fileroot[fileroot.length()-1] == '.') { fileroot = fileroot.substr(0, fileroot.length()-1); } //rip off dot
190 string extension = m->getExtension(fileroot);
191 if (extension == ".flow") { fileroot = m->getRootName(fileroot); }
192 else { fileroot += "."; } //add back if needed
194 compositeFASTAFileName = thisoutputDir + fileroot + "shhh.fasta";
195 m->openOutputFile(compositeFASTAFileName, temp);
198 compositeNamesFileName = thisoutputDir + fileroot + "shhh.names";
199 m->openOutputFile(compositeNamesFileName, temp);
203 if(flowFilesFileName != "not found"){
206 ifstream flowFilesFile;
207 m->openInputFile(flowFilesFileName, flowFilesFile);
208 while(flowFilesFile){
209 fName = m->getline(flowFilesFile);
211 //test if file is valid
213 int ableToOpen = m->openInputFile(fName, in, "noerror");
215 if (ableToOpen == 1) {
216 if (inputDir != "") { //default path is set
217 string tryPath = inputDir + fName;
218 m->mothurOut("Unable to open " + fName + ". Trying input directory " + tryPath); m->mothurOutEndLine();
220 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
226 if (ableToOpen == 1) {
227 if (m->getDefaultPath() != "") { //default path is set
228 string tryPath = m->getDefaultPath() + m->getSimpleName(fName);
229 m->mothurOut("Unable to open " + fName + ". Trying default " + tryPath); m->mothurOutEndLine();
231 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
237 //if you can't open it its not in current working directory or inputDir, try mothur excutable location
238 if (ableToOpen == 1) {
239 string exepath = m->argv;
240 string tempPath = exepath;
241 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
242 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
244 string tryPath = m->getFullPathName(exepath) + m->getSimpleName(fName);
245 m->mothurOut("Unable to open " + fName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
247 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
252 if (ableToOpen == 1) { m->mothurOut("Unable to open " + fName + ". Disregarding. "); m->mothurOutEndLine(); }
253 else { flowFileVector.push_back(fName); }
254 m->gobble(flowFilesFile);
256 flowFilesFile.close();
257 if (flowFileVector.size() == 0) { m->mothurOut("[ERROR]: no valid files."); m->mothurOutEndLine(); abort = true; }
260 if (outputDir == "") { outputDir = m->hasPath(flowFileName); }
261 flowFileVector.push_back(flowFileName);
264 //check for optional parameter and set defaults
265 // ...at some point should added some additional type checking...
267 temp = validParameter.validFile(parameters, "lookup", true);
268 if (temp == "not found") {
269 lookupFileName = "LookUp_Titanium.pat";
273 ableToOpen = m->openInputFile(lookupFileName, in, "noerror");
276 //if you can't open it, try input location
277 if (ableToOpen == 1) {
278 if (inputDir != "") { //default path is set
279 string tryPath = inputDir + lookupFileName;
280 m->mothurOut("Unable to open " + lookupFileName + ". Trying input directory " + tryPath); m->mothurOutEndLine();
282 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
284 lookupFileName = tryPath;
288 //if you can't open it, try default location
289 if (ableToOpen == 1) {
290 if (m->getDefaultPath() != "") { //default path is set
291 string tryPath = m->getDefaultPath() + m->getSimpleName(lookupFileName);
292 m->mothurOut("Unable to open " + lookupFileName + ". Trying default " + tryPath); m->mothurOutEndLine();
294 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
296 lookupFileName = tryPath;
300 //if you can't open it its not in current working directory or inputDir, try mothur excutable location
301 if (ableToOpen == 1) {
302 string exepath = m->argv;
303 string tempPath = exepath;
304 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
305 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
307 string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName);
308 m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
310 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
312 lookupFileName = tryPath;
315 if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
317 else if(temp == "not open") {
319 lookupFileName = validParameter.validFile(parameters, "lookup", false);
321 //if you can't open it its not inputDir, try mothur excutable location
322 string exepath = m->argv;
323 string tempPath = exepath;
324 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
325 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
327 string tryPath = m->getFullPathName(exepath) + lookupFileName;
328 m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
330 int ableToOpen = m->openInputFile(tryPath, in2, "noerror");
332 lookupFileName = tryPath;
334 if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
335 }else { lookupFileName = temp; }
337 temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
338 m->setProcessors(temp);
339 m->mothurConvert(temp, processors);
341 temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; }
342 m->mothurConvert(temp, cutoff);
344 temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; }
345 m->mothurConvert(temp, minDelta);
347 temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; }
348 m->mothurConvert(temp, maxIters);
350 temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; }
351 m->mothurConvert(temp, largeSize);
352 if (largeSize != 0) { large = true; }
353 else { large = false; }
354 if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); }
357 if (large) { m->mothurOut("The large parameter is not available with the MPI-Enabled version.\n"); large=false; }
361 temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; }
362 m->mothurConvert(temp, sigma);
364 temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
365 if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A or B. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC.\n"); abort=true;
368 if (toupper(temp[0]) == 'A') { flowOrder = "TACG"; }
369 else if(toupper(temp[0]) == 'B'){
370 flowOrder = "TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC"; }
372 m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A or B. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC.\n"); abort=true;
382 catch(exception& e) {
383 m->errorOut(e, "ShhherCommand", "ShhherCommand");
387 //**********************************************************************************************************************
389 int ShhherCommand::execute(){
391 if (abort == true) { if (calledHelp) { return 0; } return 2; }
398 for(int i=1;i<ncpus;i++){
399 MPI_Send(&abort, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
401 if(abort == 1){ return 0; }
405 m->mothurOut("\nGetting preliminary data...\n");
406 getSingleLookUp(); if (m->control_pressed) { return 0; }
407 getJointLookUp(); if (m->control_pressed) { return 0; }
409 vector<string> flowFileVector;
410 if(flowFilesFileName != "not found"){
413 ifstream flowFilesFile;
414 m->openInputFile(flowFilesFileName, flowFilesFile);
415 while(flowFilesFile){
416 fName = m->getline(flowFilesFile);
417 flowFileVector.push_back(fName);
418 m->gobble(flowFilesFile);
422 flowFileVector.push_back(flowFileName);
425 int numFiles = flowFileVector.size();
427 for(int i=1;i<ncpus;i++){
428 MPI_Send(&numFiles, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
431 for(int i=0;i<numFiles;i++){
433 if (m->control_pressed) { break; }
435 double begClock = clock();
436 unsigned long long begTime = time(NULL);
438 flowFileName = flowFileVector[i];
440 m->mothurOut("\n>>>>>\tProcessing " + flowFileName + " (file " + toString(i+1) + " of " + toString(numFiles) + ")\t<<<<<\n");
441 m->mothurOut("Reading flowgrams...\n");
444 if (m->control_pressed) { break; }
446 m->mothurOut("Identifying unique flowgrams...\n");
449 if (m->control_pressed) { break; }
451 m->mothurOut("Calculating distances between flowgrams...\n");
453 strcpy(fileName, flowFileName.c_str());
455 for(int i=1;i<ncpus;i++){
456 MPI_Send(&fileName[0], 1024, MPI_CHAR, i, tag, MPI_COMM_WORLD);
458 MPI_Send(&numSeqs, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
459 MPI_Send(&numUniques, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
460 MPI_Send(&numFlowCells, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
461 MPI_Send(&flowDataIntI[0], numSeqs * numFlowCells, MPI_SHORT, i, tag, MPI_COMM_WORLD);
462 MPI_Send(&flowDataPrI[0], numSeqs * numFlowCells, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
463 MPI_Send(&mapUniqueToSeq[0], numSeqs, MPI_INT, i, tag, MPI_COMM_WORLD);
464 MPI_Send(&mapSeqToUnique[0], numSeqs, MPI_INT, i, tag, MPI_COMM_WORLD);
465 MPI_Send(&lengths[0], numSeqs, MPI_INT, i, tag, MPI_COMM_WORLD);
466 MPI_Send(&jointLookUp[0], NUMBINS * NUMBINS, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
467 MPI_Send(&cutoff, 1, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
470 string distFileName = flowDistMPI(0, int(sqrt(1.0/float(ncpus)) * numUniques));
472 if (m->control_pressed) { break; }
475 for(int i=1;i<ncpus;i++){
476 MPI_Recv(&done, 1, MPI_INT, i, tag, MPI_COMM_WORLD, &status);
478 m->appendFiles((distFileName + ".temp." + toString(i)), distFileName);
479 m->mothurRemove((distFileName + ".temp." + toString(i)));
482 string namesFileName = createNamesFile();
484 if (m->control_pressed) { break; }
486 m->mothurOut("\nClustering flowgrams...\n");
487 string listFileName = cluster(distFileName, namesFileName);
489 if (m->control_pressed) { break; }
493 getOTUData(listFileName);
495 m->mothurRemove(distFileName);
496 m->mothurRemove(namesFileName);
497 m->mothurRemove(listFileName);
499 if (m->control_pressed) { break; }
503 if (m->control_pressed) { break; }
506 for(int i=1;i<ncpus;i++){
507 MPI_Send(&numOTUs, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
508 MPI_Send(&singleLookUp[0], singleLookUp.size(), MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
509 MPI_Send(&uniqueFlowgrams[0], numFlowCells * numUniques, MPI_SHORT, i, tag, MPI_COMM_WORLD);
510 MPI_Send(&sigma, 1, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
513 if (m->control_pressed) { break; }
518 int numOTUsOnCPU = numOTUs / ncpus;
519 int numSeqsOnCPU = numSeqs / ncpus;
520 m->mothurOut("\nDenoising flowgrams...\n");
521 m->mothurOut("iter\tmaxDelta\tnLL\t\tcycletime\n");
523 while((maxIters == 0 && maxDelta > minDelta) || iter < MIN_ITER || (maxDelta > minDelta && iter < maxIters)){
525 double cycClock = clock();
526 unsigned long long cycTime = time(NULL);
529 if (m->control_pressed) { break; }
531 int total = singleTau.size();
532 for(int i=1;i<ncpus;i++){
533 MPI_Send(&total, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
534 MPI_Send(&change[0], numOTUs, MPI_SHORT, i, tag, MPI_COMM_WORLD);
535 MPI_Send(¢roids[0], numOTUs, MPI_INT, i, tag, MPI_COMM_WORLD);
537 MPI_Send(&singleTau[0], total, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
538 MPI_Send(&seqNumber[0], total, MPI_INT, i, tag, MPI_COMM_WORLD);
539 MPI_Send(&seqIndex[0], total, MPI_INT, i, tag, MPI_COMM_WORLD);
540 MPI_Send(&nSeqsPerOTU[0], numOTUs, MPI_INT, i, tag, MPI_COMM_WORLD);
541 MPI_Send(&cumNumSeqs[0], numOTUs, MPI_INT, i, tag, MPI_COMM_WORLD);
544 calcCentroidsDriver(0, numOTUsOnCPU);
546 for(int i=1;i<ncpus;i++){
547 int otuStart = i * numOTUs / ncpus;
548 int otuStop = (i + 1) * numOTUs / ncpus;
550 vector<int> tempCentroids(numOTUs, 0);
551 vector<short> tempChange(numOTUs, 0);
553 MPI_Recv(&tempCentroids[0], numOTUs, MPI_INT, i, tag, MPI_COMM_WORLD, &status);
554 MPI_Recv(&tempChange[0], numOTUs, MPI_SHORT, i, tag, MPI_COMM_WORLD, &status);
556 for(int j=otuStart;j<otuStop;j++){
557 centroids[j] = tempCentroids[j];
558 change[j] = tempChange[j];
562 maxDelta = getNewWeights(); if (m->control_pressed) { break; }
563 double nLL = getLikelihood(); if (m->control_pressed) { break; }
564 checkCentroids(); if (m->control_pressed) { break; }
566 for(int i=1;i<ncpus;i++){
567 MPI_Send(¢roids[0], numOTUs, MPI_INT, i, tag, MPI_COMM_WORLD);
568 MPI_Send(&weight[0], numOTUs, MPI_DOUBLE, i, tag, MPI_COMM_WORLD);
569 MPI_Send(&change[0], numOTUs, MPI_SHORT, i, tag, MPI_COMM_WORLD);
572 calcNewDistancesParent(0, numSeqsOnCPU);
574 total = singleTau.size();
576 for(int i=1;i<ncpus;i++){
578 int seqStart = i * numSeqs / ncpus;
579 int seqStop = (i + 1) * numSeqs / ncpus;
581 MPI_Recv(&childTotal, 1, MPI_INT, i, tag, MPI_COMM_WORLD, &status);
583 vector<int> childSeqIndex(childTotal, 0);
584 vector<double> childSingleTau(childTotal, 0);
585 vector<double> childDist(numSeqs * numOTUs, 0);
586 vector<int> otuIndex(childTotal, 0);
588 MPI_Recv(&childSeqIndex[0], childTotal, MPI_INT, i, tag, MPI_COMM_WORLD, &status);
589 MPI_Recv(&childSingleTau[0], childTotal, MPI_DOUBLE, i, tag, MPI_COMM_WORLD, &status);
590 MPI_Recv(&childDist[0], numOTUs * numSeqs, MPI_DOUBLE, i, tag, MPI_COMM_WORLD, &status);
591 MPI_Recv(&otuIndex[0], childTotal, MPI_INT, i, tag, MPI_COMM_WORLD, &status);
593 int oldTotal = total;
595 singleTau.resize(total, 0);
596 seqIndex.resize(total, 0);
597 seqNumber.resize(total, 0);
601 for(int j=oldTotal;j<total;j++){
602 int otuI = otuIndex[childIndex];
603 int seqI = childSeqIndex[childIndex];
605 singleTau[j] = childSingleTau[childIndex];
607 aaP[otuI][nSeqsPerOTU[otuI]] = j;
608 aaI[otuI][nSeqsPerOTU[otuI]] = seqI;
613 int index = seqStart * numOTUs;
614 for(int j=seqStart;j<seqStop;j++){
615 for(int k=0;k<numOTUs;k++){
616 dist[index] = childDist[index];
624 m->mothurOut(toString(iter) + '\t' + toString(maxDelta) + '\t' + toString(nLL) + '\t' + toString(time(NULL) - cycTime) + '\t' + toString((clock() - cycClock)/(double)CLOCKS_PER_SEC) + '\n');
626 if((maxIters == 0 && maxDelta > minDelta) || iter < MIN_ITER || (maxDelta > minDelta && iter < maxIters)){
628 for(int i=1;i<ncpus;i++){
629 MPI_Send(&live, 1, MPI_INT, i, tag, MPI_COMM_WORLD);
634 for(int i=1;i<ncpus;i++){
635 MPI_Send(&live, 1, MPI_INT, i, tag, MPI_COMM_WORLD); //send kill command
641 if (m->control_pressed) { break; }
643 m->mothurOut("\nFinalizing...\n");
646 if (m->control_pressed) { break; }
650 vector<int> otuCounts(numOTUs, 0);
651 for(int i=0;i<numSeqs;i++) { otuCounts[otuData[i]]++; }
652 calcCentroidsDriver(0, numOTUs);
654 if (m->control_pressed) { break; }
656 writeQualities(otuCounts); if (m->control_pressed) { break; }
657 writeSequences(otuCounts); if (m->control_pressed) { break; }
658 writeNames(otuCounts); if (m->control_pressed) { break; }
659 writeClusters(otuCounts); if (m->control_pressed) { break; }
660 writeGroups(); if (m->control_pressed) { break; }
663 m->mothurOut("Total time to process " + toString(flowFileName) + ":\t" + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/(double)CLOCKS_PER_SEC) + '\n');
669 MPI_Recv(&abort, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
670 if(abort){ return 0; }
673 MPI_Recv(&numFiles, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
675 for(int i=0;i<numFiles;i++){
677 if (m->control_pressed) { break; }
679 //Now into the pyrodist part
683 MPI_Recv(&fileName, 1024, MPI_CHAR, 0, tag, MPI_COMM_WORLD, &status);
684 MPI_Recv(&numSeqs, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
685 MPI_Recv(&numUniques, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
686 MPI_Recv(&numFlowCells, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
688 flowDataIntI.resize(numSeqs * numFlowCells);
689 flowDataPrI.resize(numSeqs * numFlowCells);
690 mapUniqueToSeq.resize(numSeqs);
691 mapSeqToUnique.resize(numSeqs);
692 lengths.resize(numSeqs);
693 jointLookUp.resize(NUMBINS * NUMBINS);
695 MPI_Recv(&flowDataIntI[0], numSeqs * numFlowCells, MPI_SHORT, 0, tag, MPI_COMM_WORLD, &status);
696 MPI_Recv(&flowDataPrI[0], numSeqs * numFlowCells, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
697 MPI_Recv(&mapUniqueToSeq[0], numSeqs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
698 MPI_Recv(&mapSeqToUnique[0], numSeqs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
699 MPI_Recv(&lengths[0], numSeqs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
700 MPI_Recv(&jointLookUp[0], NUMBINS * NUMBINS, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
701 MPI_Recv(&cutoff, 1, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
703 flowFileName = string(fileName);
704 int flowDistStart = int(sqrt(float(pid)/float(ncpus)) * numUniques);
705 int flowDistEnd = int(sqrt(float(pid+1)/float(ncpus)) * numUniques);
707 string distanceStringChild = flowDistMPI(flowDistStart, flowDistEnd);
709 if (m->control_pressed) { break; }
712 MPI_Send(&done, 1, MPI_INT, 0, tag, MPI_COMM_WORLD);
714 //Now into the pyronoise part
715 MPI_Recv(&numOTUs, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
717 singleLookUp.resize(HOMOPS * NUMBINS);
718 uniqueFlowgrams.resize(numUniques * numFlowCells);
719 weight.resize(numOTUs);
720 centroids.resize(numOTUs);
721 change.resize(numOTUs);
722 dist.assign(numOTUs * numSeqs, 0);
723 nSeqsPerOTU.resize(numOTUs);
724 cumNumSeqs.resize(numOTUs);
726 MPI_Recv(&singleLookUp[0], singleLookUp.size(), MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
727 MPI_Recv(&uniqueFlowgrams[0], uniqueFlowgrams.size(), MPI_SHORT, 0, tag, MPI_COMM_WORLD, &status);
728 MPI_Recv(&sigma, 1, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
730 int startOTU = pid * numOTUs / ncpus;
731 int endOTU = (pid + 1) * numOTUs / ncpus;
733 int startSeq = pid * numSeqs / ncpus;
734 int endSeq = (pid + 1) * numSeqs /ncpus;
740 if (m->control_pressed) { break; }
742 MPI_Recv(&total, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
743 singleTau.assign(total, 0.0000);
744 seqNumber.assign(total, 0);
745 seqIndex.assign(total, 0);
747 MPI_Recv(&change[0], numOTUs, MPI_SHORT, 0, tag, MPI_COMM_WORLD, &status);
748 MPI_Recv(¢roids[0], numOTUs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
749 MPI_Recv(&singleTau[0], total, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
750 MPI_Recv(&seqNumber[0], total, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
751 MPI_Recv(&seqIndex[0], total, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
752 MPI_Recv(&nSeqsPerOTU[0], total, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
753 MPI_Recv(&cumNumSeqs[0], numOTUs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
755 calcCentroidsDriver(startOTU, endOTU);
757 MPI_Send(¢roids[0], numOTUs, MPI_INT, 0, tag, MPI_COMM_WORLD);
758 MPI_Send(&change[0], numOTUs, MPI_SHORT, 0, tag, MPI_COMM_WORLD);
760 MPI_Recv(¢roids[0], numOTUs, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
761 MPI_Recv(&weight[0], numOTUs, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD, &status);
762 MPI_Recv(&change[0], numOTUs, MPI_SHORT, 0, tag, MPI_COMM_WORLD, &status);
764 vector<int> otuIndex(total, 0);
765 calcNewDistancesChildMPI(startSeq, endSeq, otuIndex);
766 total = otuIndex.size();
768 MPI_Send(&total, 1, MPI_INT, 0, tag, MPI_COMM_WORLD);
769 MPI_Send(&seqIndex[0], total, MPI_INT, 0, tag, MPI_COMM_WORLD);
770 MPI_Send(&singleTau[0], total, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD);
771 MPI_Send(&dist[0], numOTUs * numSeqs, MPI_DOUBLE, 0, tag, MPI_COMM_WORLD);
772 MPI_Send(&otuIndex[0], total, MPI_INT, 0, tag, MPI_COMM_WORLD);
774 MPI_Recv(&live, 1, MPI_INT, 0, tag, MPI_COMM_WORLD, &status);
779 if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; }
781 MPI_Barrier(MPI_COMM_WORLD);
784 if(compositeFASTAFileName != ""){
785 outputNames.push_back(compositeFASTAFileName); outputTypes["fasta"].push_back(compositeFASTAFileName);
786 outputNames.push_back(compositeNamesFileName); outputTypes["name"].push_back(compositeNamesFileName);
789 m->mothurOutEndLine();
790 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
791 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
792 m->mothurOutEndLine();
797 catch(exception& e) {
798 m->errorOut(e, "ShhherCommand", "execute");
802 /**************************************************************************************************/
803 string ShhherCommand::createNamesFile(){
806 vector<string> duplicateNames(numUniques, "");
807 for(int i=0;i<numSeqs;i++){
808 duplicateNames[mapSeqToUnique[i]] += seqNameVector[i] + ',';
810 map<string, string> variables;
811 variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
812 string nameFileName = getOutputFileName("name",variables);
815 m->openOutputFile(nameFileName, nameFile);
817 for(int i=0;i<numUniques;i++){
819 if (m->control_pressed) { break; }
821 // nameFile << seqNameVector[mapUniqueToSeq[i]] << '\t' << duplicateNames[i].substr(0, duplicateNames[i].find_last_of(',')) << endl;
822 nameFile << mapUniqueToSeq[i] << '\t' << duplicateNames[i].substr(0, duplicateNames[i].find_last_of(',')) << endl;
828 catch(exception& e) {
829 m->errorOut(e, "ShhherCommand", "createNamesFile");
833 /**************************************************************************************************/
835 string ShhherCommand::flowDistMPI(int startSeq, int stopSeq){
837 ostringstream outStream;
838 outStream.setf(ios::fixed, ios::floatfield);
839 outStream.setf(ios::dec, ios::basefield);
840 outStream.setf(ios::showpoint);
841 outStream.precision(6);
843 int begTime = time(NULL);
844 double begClock = clock();
846 for(int i=startSeq;i<stopSeq;i++){
848 if (m->control_pressed) { break; }
850 for(int j=0;j<i;j++){
851 float flowDistance = calcPairwiseDist(mapUniqueToSeq[i], mapUniqueToSeq[j]);
853 if(flowDistance < 1e-6){
854 outStream << mapUniqueToSeq[i] << '\t' << mapUniqueToSeq[j] << '\t' << 0.000000 << endl;
856 else if(flowDistance <= cutoff){
857 outStream << mapUniqueToSeq[i] << '\t' << mapUniqueToSeq[j] << '\t' << flowDistance << endl;
861 m->mothurOut(toString(i) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
865 string fDistFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.dist";
866 if(pid != 0){ fDistFileName += ".temp." + toString(pid); }
868 if (m->control_pressed) { return fDistFileName; }
870 m->mothurOut(toString(stopSeq) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
872 ofstream distFile(fDistFileName.c_str());
873 distFile << outStream.str();
876 return fDistFileName;
878 catch(exception& e) {
879 m->errorOut(e, "ShhherCommand", "flowDistMPI");
883 /**************************************************************************************************/
885 void ShhherCommand::getOTUData(string listFileName){
889 m->openInputFile(listFileName, listFile);
892 listFile >> label >> numOTUs;
894 otuData.assign(numSeqs, 0);
895 cumNumSeqs.assign(numOTUs, 0);
896 nSeqsPerOTU.assign(numOTUs, 0);
897 aaP.clear();aaP.resize(numOTUs);
903 string singleOTU = "";
905 for(int i=0;i<numOTUs;i++){
907 if (m->control_pressed) { break; }
909 listFile >> singleOTU;
911 istringstream otuString(singleOTU);
917 for(int j=0;j<singleOTU.length();j++){
918 char letter = otuString.get();
924 map<string,int>::iterator nmIt = nameMap.find(seqName);
925 int index = nmIt->second;
931 aaP[i].push_back(index);
936 map<string,int>::iterator nmIt = nameMap.find(seqName);
938 int index = nmIt->second;
943 aaP[i].push_back(index);
948 sort(aaP[i].begin(), aaP[i].end());
949 for(int j=0;j<nSeqsPerOTU[i];j++){
950 seqNumber.push_back(aaP[i][j]);
952 for(int j=nSeqsPerOTU[i];j<numSeqs;j++){
959 for(int i=1;i<numOTUs;i++){
960 cumNumSeqs[i] = cumNumSeqs[i-1] + nSeqsPerOTU[i-1];
963 seqIndex = seqNumber;
968 catch(exception& e) {
969 m->errorOut(e, "ShhherCommand", "getOTUData");
974 /**************************************************************************************************/
976 void ShhherCommand::initPyroCluster(){
978 if (numOTUs < processors) { processors = 1; }
980 if (m->debug) { m->mothurOut("[DEBUG]: numSeqs = " + toString(numSeqs) + " numOTUS = " + toString(numOTUs) + " about to alloc a dist vector with size = " + toString((numSeqs * numOTUs)) + ".\n"); }
982 dist.assign(numSeqs * numOTUs, 0);
983 change.assign(numOTUs, 1);
984 centroids.assign(numOTUs, -1);
985 weight.assign(numOTUs, 0);
986 singleTau.assign(numSeqs, 1.0);
988 nSeqsBreaks.assign(processors+1, 0);
989 nOTUsBreaks.assign(processors+1, 0);
991 if (m->debug) { m->mothurOut("[DEBUG]: made it through the memory allocation.\n"); }
994 for(int i=0;i<processors;i++){
995 nSeqsBreaks[i+1] = nSeqsBreaks[i] + (int)((double) numSeqs / (double) processors);
996 nOTUsBreaks[i+1] = nOTUsBreaks[i] + (int)((double) numOTUs / (double) processors);
998 nSeqsBreaks[processors] = numSeqs;
999 nOTUsBreaks[processors] = numOTUs;
1001 catch(exception& e) {
1002 m->errorOut(e, "ShhherCommand", "initPyroCluster");
1007 /**************************************************************************************************/
1009 void ShhherCommand::fill(){
1012 for(int i=0;i<numOTUs;i++){
1014 if (m->control_pressed) { break; }
1016 cumNumSeqs[i] = index;
1017 for(int j=0;j<nSeqsPerOTU[i];j++){
1018 seqNumber[index] = aaP[i][j];
1019 seqIndex[index] = aaI[i][j];
1025 catch(exception& e) {
1026 m->errorOut(e, "ShhherCommand", "fill");
1031 /**************************************************************************************************/
1033 void ShhherCommand::getFlowData(){
1036 m->openInputFile(flowFileName, flowFile);
1039 seqNameVector.clear();
1041 flowDataIntI.clear();
1045 int currentNumFlowCells;
1050 flowFile >> numFlowTest;
1052 if (!m->isContainingOnlyDigits(numFlowTest)) { m->mothurOut("[ERROR]: expected a number and got " + numFlowTest + ", quitting. Did you use the flow parameter instead of the file parameter?"); m->mothurOutEndLine(); exit(1); }
1053 else { convert(numFlowTest, numFlowCells); }
1055 int index = 0;//pcluster
1056 while(!flowFile.eof()){
1058 if (m->control_pressed) { break; }
1060 flowFile >> seqName >> currentNumFlowCells;
1061 lengths.push_back(currentNumFlowCells);
1063 seqNameVector.push_back(seqName);
1064 nameMap[seqName] = index++;//pcluster
1066 for(int i=0;i<numFlowCells;i++){
1067 flowFile >> intensity;
1068 if(intensity > 9.99) { intensity = 9.99; }
1069 int intI = int(100 * intensity + 0.0001);
1070 flowDataIntI.push_back(intI);
1072 m->gobble(flowFile);
1076 numSeqs = seqNameVector.size();
1078 for(int i=0;i<numSeqs;i++){
1080 if (m->control_pressed) { break; }
1082 int iNumFlowCells = i * numFlowCells;
1083 for(int j=lengths[i];j<numFlowCells;j++){
1084 flowDataIntI[iNumFlowCells + j] = 0;
1089 catch(exception& e) {
1090 m->errorOut(e, "ShhherCommand", "getFlowData");
1094 /**************************************************************************************************/
1095 void ShhherCommand::calcNewDistancesChildMPI(int startSeq, int stopSeq, vector<int>& otuIndex){
1098 vector<double> newTau(numOTUs,0);
1099 vector<double> norms(numSeqs, 0);
1104 for(int i=startSeq;i<stopSeq;i++){
1106 if (m->control_pressed) { break; }
1108 double offset = 1e8;
1109 int indexOffset = i * numOTUs;
1111 for(int j=0;j<numOTUs;j++){
1113 if(weight[j] > MIN_WEIGHT && change[j] == 1){
1114 dist[indexOffset + j] = getDistToCentroid(centroids[j], i, lengths[i]);
1116 if(weight[j] > MIN_WEIGHT && dist[indexOffset + j] < offset){
1117 offset = dist[indexOffset + j];
1121 for(int j=0;j<numOTUs;j++){
1122 if(weight[j] > MIN_WEIGHT){
1123 newTau[j] = exp(sigma * (-dist[indexOffset + j] + offset)) * weight[j];
1124 norms[i] += newTau[j];
1131 for(int j=0;j<numOTUs;j++){
1133 newTau[j] /= norms[i];
1135 if(newTau[j] > MIN_TAU){
1136 otuIndex.push_back(j);
1137 seqIndex.push_back(i);
1138 singleTau.push_back(newTau[j]);
1144 catch(exception& e) {
1145 m->errorOut(e, "ShhherCommand", "calcNewDistancesChildMPI");
1150 /**************************************************************************************************/
1152 void ShhherCommand::calcNewDistancesParent(int startSeq, int stopSeq){
1157 vector<double> newTau(numOTUs,0);
1158 vector<double> norms(numSeqs, 0);
1159 nSeqsPerOTU.assign(numOTUs, 0);
1161 for(int i=startSeq;i<stopSeq;i++){
1163 if (m->control_pressed) { break; }
1165 int indexOffset = i * numOTUs;
1167 double offset = 1e8;
1169 for(int j=0;j<numOTUs;j++){
1171 if(weight[j] > MIN_WEIGHT && change[j] == 1){
1172 dist[indexOffset + j] = getDistToCentroid(centroids[j], i, lengths[i]);
1175 if(weight[j] > MIN_WEIGHT && dist[indexOffset + j] < offset){
1176 offset = dist[indexOffset + j];
1180 for(int j=0;j<numOTUs;j++){
1181 if(weight[j] > MIN_WEIGHT){
1182 newTau[j] = exp(sigma * (-dist[indexOffset + j] + offset)) * weight[j];
1183 norms[i] += newTau[j];
1190 for(int j=0;j<numOTUs;j++){
1191 newTau[j] /= norms[i];
1194 for(int j=0;j<numOTUs;j++){
1195 if(newTau[j] > MIN_TAU){
1197 int oldTotal = total;
1201 singleTau.resize(total, 0);
1202 seqNumber.resize(total, 0);
1203 seqIndex.resize(total, 0);
1205 singleTau[oldTotal] = newTau[j];
1207 aaP[j][nSeqsPerOTU[j]] = oldTotal;
1208 aaI[j][nSeqsPerOTU[j]] = i;
1216 catch(exception& e) {
1217 m->errorOut(e, "ShhherCommand", "calcNewDistancesParent");
1222 /**************************************************************************************************/
1224 void ShhherCommand::setOTUs(){
1227 vector<double> bigTauMatrix(numOTUs * numSeqs, 0.0000);
1229 for(int i=0;i<numOTUs;i++){
1231 if (m->control_pressed) { break; }
1233 for(int j=0;j<nSeqsPerOTU[i];j++){
1234 int index = cumNumSeqs[i] + j;
1235 double tauValue = singleTau[seqNumber[index]];
1236 int sIndex = seqIndex[index];
1237 bigTauMatrix[sIndex * numOTUs + i] = tauValue;
1241 for(int i=0;i<numSeqs;i++){
1242 double maxTau = -1.0000;
1244 for(int j=0;j<numOTUs;j++){
1245 if(bigTauMatrix[i * numOTUs + j] > maxTau){
1246 maxTau = bigTauMatrix[i * numOTUs + j];
1251 otuData[i] = maxOTU;
1254 nSeqsPerOTU.assign(numOTUs, 0);
1256 for(int i=0;i<numSeqs;i++){
1257 int index = otuData[i];
1259 singleTau[i] = 1.0000;
1262 aaP[index][nSeqsPerOTU[index]] = i;
1263 aaI[index][nSeqsPerOTU[index]] = i;
1265 nSeqsPerOTU[index]++;
1269 catch(exception& e) {
1270 m->errorOut(e, "ShhherCommand", "setOTUs");
1275 /**************************************************************************************************/
1277 void ShhherCommand::getUniques(){
1282 uniqueFlowgrams.assign(numFlowCells * numSeqs, -1);
1283 uniqueCount.assign(numSeqs, 0); // anWeights
1284 uniqueLengths.assign(numSeqs, 0);
1285 mapSeqToUnique.assign(numSeqs, -1);
1286 mapUniqueToSeq.assign(numSeqs, -1);
1288 vector<short> uniqueFlowDataIntI(numFlowCells * numSeqs, -1);
1290 for(int i=0;i<numSeqs;i++){
1292 if (m->control_pressed) { break; }
1296 vector<short> current(numFlowCells);
1297 for(int j=0;j<numFlowCells;j++){
1298 current[j] = short(((flowDataIntI[i * numFlowCells + j] + 50.0)/100.0));
1301 for(int j=0;j<numUniques;j++){
1302 int offset = j * numFlowCells;
1306 if(lengths[i] < uniqueLengths[j]) { shorterLength = lengths[i]; }
1307 else { shorterLength = uniqueLengths[j]; }
1309 for(int k=0;k<shorterLength;k++){
1310 if(current[k] != uniqueFlowgrams[offset + k]){
1317 mapSeqToUnique[i] = j;
1320 if(lengths[i] > uniqueLengths[j]) { uniqueLengths[j] = lengths[i]; }
1326 if(index == numUniques){
1327 uniqueLengths[numUniques] = lengths[i];
1328 uniqueCount[numUniques] = 1;
1329 mapSeqToUnique[i] = numUniques;//anMap
1330 mapUniqueToSeq[numUniques] = i;//anF
1332 for(int k=0;k<numFlowCells;k++){
1333 uniqueFlowgrams[numUniques * numFlowCells + k] = current[k];
1334 uniqueFlowDataIntI[numUniques * numFlowCells + k] = flowDataIntI[i * numFlowCells + k];
1340 uniqueFlowDataIntI.resize(numFlowCells * numUniques);
1341 uniqueLengths.resize(numUniques);
1343 flowDataPrI.resize(numSeqs * numFlowCells, 0);
1344 for(int i=0;i<flowDataPrI.size();i++) { if (m->control_pressed) { break; } flowDataPrI[i] = getProbIntensity(flowDataIntI[i]); }
1346 catch(exception& e) {
1347 m->errorOut(e, "ShhherCommand", "getUniques");
1352 /**************************************************************************************************/
1354 float ShhherCommand::calcPairwiseDist(int seqA, int seqB){
1356 int minLength = lengths[mapSeqToUnique[seqA]];
1357 if(lengths[seqB] < minLength){ minLength = lengths[mapSeqToUnique[seqB]]; }
1359 int ANumFlowCells = seqA * numFlowCells;
1360 int BNumFlowCells = seqB * numFlowCells;
1364 for(int i=0;i<minLength;i++){
1366 if (m->control_pressed) { break; }
1368 int flowAIntI = flowDataIntI[ANumFlowCells + i];
1369 float flowAPrI = flowDataPrI[ANumFlowCells + i];
1371 int flowBIntI = flowDataIntI[BNumFlowCells + i];
1372 float flowBPrI = flowDataPrI[BNumFlowCells + i];
1373 dist += jointLookUp[flowAIntI * NUMBINS + flowBIntI] - flowAPrI - flowBPrI;
1376 dist /= (float) minLength;
1379 catch(exception& e) {
1380 m->errorOut(e, "ShhherCommand", "calcPairwiseDist");
1385 //**********************************************************************************************************************/
1387 string ShhherCommand::cluster(string distFileName, string namesFileName){
1390 ReadMatrix* read = new ReadColumnMatrix(distFileName);
1391 read->setCutoff(cutoff);
1393 NameAssignment* clusterNameMap = new NameAssignment(namesFileName);
1394 clusterNameMap->readMap();
1395 read->read(clusterNameMap);
1397 ListVector* list = read->getListVector();
1398 SparseDistanceMatrix* matrix = read->getDMatrix();
1401 delete clusterNameMap;
1403 RAbundVector* rabund = new RAbundVector(list->getRAbundVector());
1405 Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest");
1406 string tag = cluster->getTag();
1408 double clusterCutoff = cutoff;
1409 while (matrix->getSmallDist() <= clusterCutoff && matrix->getNNodes() > 0){
1411 if (m->control_pressed) { break; }
1413 cluster->update(clusterCutoff);
1416 list->setLabel(toString(cutoff));
1418 string listFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.list";
1420 m->openOutputFile(listFileName, listFile);
1421 list->print(listFile);
1424 delete matrix; delete cluster; delete rabund; delete list;
1426 return listFileName;
1428 catch(exception& e) {
1429 m->errorOut(e, "ShhherCommand", "cluster");
1434 /**************************************************************************************************/
1436 void ShhherCommand::calcCentroidsDriver(int start, int finish){
1438 //this function gets the most likely homopolymer length at a flow position for a group of sequences
1443 for(int i=start;i<finish;i++){
1445 if (m->control_pressed) { break; }
1449 int minFlowGram = 100000000;
1450 double minFlowValue = 1e8;
1451 change[i] = 0; //FALSE
1453 for(int j=0;j<nSeqsPerOTU[i];j++){
1454 count += singleTau[seqNumber[cumNumSeqs[i] + j]];
1457 if(nSeqsPerOTU[i] > 0 && count > MIN_COUNT){
1458 vector<double> adF(nSeqsPerOTU[i]);
1459 vector<int> anL(nSeqsPerOTU[i]);
1461 for(int j=0;j<nSeqsPerOTU[i];j++){
1462 int index = cumNumSeqs[i] + j;
1463 int nI = seqIndex[index];
1464 int nIU = mapSeqToUnique[nI];
1467 for(k=0;k<position;k++){
1473 anL[position] = nIU;
1474 adF[position] = 0.0000;
1479 for(int j=0;j<nSeqsPerOTU[i];j++){
1480 int index = cumNumSeqs[i] + j;
1481 int nI = seqIndex[index];
1483 double tauValue = singleTau[seqNumber[index]];
1485 for(int k=0;k<position;k++){
1486 double dist = getDistToCentroid(anL[k], nI, lengths[nI]);
1487 adF[k] += dist * tauValue;
1491 for(int j=0;j<position;j++){
1492 if(adF[j] < minFlowValue){
1494 minFlowValue = adF[j];
1498 if(centroids[i] != anL[minFlowGram]){
1500 centroids[i] = anL[minFlowGram];
1503 else if(centroids[i] != -1){
1509 catch(exception& e) {
1510 m->errorOut(e, "ShhherCommand", "calcCentroidsDriver");
1515 /**************************************************************************************************/
1517 double ShhherCommand::getDistToCentroid(int cent, int flow, int length){
1520 int flowAValue = cent * numFlowCells;
1521 int flowBValue = flow * numFlowCells;
1525 for(int i=0;i<length;i++){
1526 dist += singleLookUp[uniqueFlowgrams[flowAValue] * NUMBINS + flowDataIntI[flowBValue]];
1531 return dist / (double)length;
1533 catch(exception& e) {
1534 m->errorOut(e, "ShhherCommand", "getDistToCentroid");
1539 /**************************************************************************************************/
1541 double ShhherCommand::getNewWeights(){
1544 double maxChange = 0;
1546 for(int i=0;i<numOTUs;i++){
1548 if (m->control_pressed) { break; }
1550 double difference = weight[i];
1553 for(int j=0;j<nSeqsPerOTU[i];j++){
1554 int index = cumNumSeqs[i] + j;
1555 double tauValue = singleTau[seqNumber[index]];
1556 weight[i] += tauValue;
1559 difference = fabs(weight[i] - difference);
1560 if(difference > maxChange){ maxChange = difference; }
1564 catch(exception& e) {
1565 m->errorOut(e, "ShhherCommand", "getNewWeights");
1570 /**************************************************************************************************/
1572 double ShhherCommand::getLikelihood(){
1576 vector<long double> P(numSeqs, 0);
1579 for(int i=0;i<numOTUs;i++){
1580 if(weight[i] > MIN_WEIGHT){
1586 for(int i=0;i<numOTUs;i++){
1588 if (m->control_pressed) { break; }
1590 for(int j=0;j<nSeqsPerOTU[i];j++){
1591 int index = cumNumSeqs[i] + j;
1592 int nI = seqIndex[index];
1593 double singleDist = dist[seqNumber[index]];
1595 P[nI] += weight[i] * exp(-singleDist * sigma);
1599 for(int i=0;i<numSeqs;i++){
1600 if(P[i] == 0){ P[i] = DBL_EPSILON; }
1605 nLL = nLL -(double)numSeqs * log(sigma);
1609 catch(exception& e) {
1610 m->errorOut(e, "ShhherCommand", "getNewWeights");
1615 /**************************************************************************************************/
1617 void ShhherCommand::checkCentroids(){
1619 vector<int> unique(numOTUs, 1);
1621 for(int i=0;i<numOTUs;i++){
1622 if(centroids[i] == -1 || weight[i] < MIN_WEIGHT){
1627 for(int i=0;i<numOTUs;i++){
1629 if (m->control_pressed) { break; }
1632 for(int j=i+1;j<numOTUs;j++){
1635 if(centroids[j] == centroids[i]){
1639 weight[i] += weight[j];
1647 catch(exception& e) {
1648 m->errorOut(e, "ShhherCommand", "checkCentroids");
1652 /**************************************************************************************************/
1656 void ShhherCommand::writeQualities(vector<int> otuCounts){
1659 string thisOutputDir = outputDir;
1660 if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
1661 map<string, string> variables;
1662 variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
1663 string qualityFileName = getOutputFileName("qfile",variables);
1665 ofstream qualityFile;
1666 m->openOutputFile(qualityFileName, qualityFile);
1668 qualityFile.setf(ios::fixed, ios::floatfield);
1669 qualityFile.setf(ios::showpoint);
1670 qualityFile << setprecision(6);
1672 vector<vector<int> > qualities(numOTUs);
1673 vector<double> pr(HOMOPS, 0);
1676 for(int i=0;i<numOTUs;i++){
1678 if (m->control_pressed) { break; }
1683 if(nSeqsPerOTU[i] > 0){
1684 qualities[i].assign(1024, -1);
1686 while(index < numFlowCells){
1687 double maxPrValue = 1e8;
1688 short maxPrIndex = -1;
1689 double count = 0.0000;
1691 pr.assign(HOMOPS, 0);
1693 for(int j=0;j<nSeqsPerOTU[i];j++){
1694 int lIndex = cumNumSeqs[i] + j;
1695 double tauValue = singleTau[seqNumber[lIndex]];
1696 int sequenceIndex = aaI[i][j];
1697 short intensity = flowDataIntI[sequenceIndex * numFlowCells + index];
1701 for(int s=0;s<HOMOPS;s++){
1702 pr[s] += tauValue * singleLookUp[s * NUMBINS + intensity];
1706 maxPrIndex = uniqueFlowgrams[centroids[i] * numFlowCells + index];
1707 maxPrValue = pr[maxPrIndex];
1709 if(count > MIN_COUNT){
1711 double norm = 0.0000;
1713 for(int s=0;s<HOMOPS;s++){
1714 norm += exp(-(pr[s] - maxPrValue));
1717 for(int s=1;s<=maxPrIndex;s++){
1719 double temp = 0.0000;
1721 U += exp(-(pr[s-1]-maxPrValue))/norm;
1729 temp = floor(-10 * temp);
1730 value = (int)floor(temp);
1731 if(value > 100){ value = 100; }
1733 qualities[i][base] = (int)value;
1743 if(otuCounts[i] > 0){
1744 qualityFile << '>' << seqNameVector[mapUniqueToSeq[i]] << endl;
1746 int j=4; //need to get past the first four bases
1747 while(qualities[i][j] != -1){
1748 qualityFile << qualities[i][j] << ' ';
1751 qualityFile << endl;
1754 qualityFile.close();
1755 outputNames.push_back(qualityFileName); outputTypes["qfile"].push_back(qualityFileName);
1758 catch(exception& e) {
1759 m->errorOut(e, "ShhherCommand", "writeQualities");
1764 /**************************************************************************************************/
1766 void ShhherCommand::writeSequences(vector<int> otuCounts){
1768 string thisOutputDir = outputDir;
1769 if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
1770 map<string, string> variables;
1771 variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
1772 string fastaFileName = getOutputFileName("fasta",variables);
1774 m->openOutputFile(fastaFileName, fastaFile);
1776 vector<string> names(numOTUs, "");
1778 for(int i=0;i<numOTUs;i++){
1780 if (m->control_pressed) { break; }
1782 int index = centroids[i];
1784 if(otuCounts[i] > 0){
1785 fastaFile << '>' << seqNameVector[aaI[i][0]] << endl;
1789 for(int j=0;j<numFlowCells;j++){
1791 char base = flowOrder[j % flowOrder.length()];
1792 for(int k=0;k<uniqueFlowgrams[index * numFlowCells + j];k++){
1797 fastaFile << newSeq.substr(4) << endl;
1802 outputNames.push_back(fastaFileName); outputTypes["fasta"].push_back(fastaFileName);
1804 if(compositeFASTAFileName != ""){
1805 m->appendFiles(fastaFileName, compositeFASTAFileName);
1808 catch(exception& e) {
1809 m->errorOut(e, "ShhherCommand", "writeSequences");
1814 /**************************************************************************************************/
1816 void ShhherCommand::writeNames(vector<int> otuCounts){
1818 string thisOutputDir = outputDir;
1819 if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
1820 map<string, string> variables;
1821 variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
1822 string nameFileName = getOutputFileName("name",variables);
1824 m->openOutputFile(nameFileName, nameFile);
1826 for(int i=0;i<numOTUs;i++){
1828 if (m->control_pressed) { break; }
1830 if(otuCounts[i] > 0){
1831 nameFile << seqNameVector[aaI[i][0]] << '\t' << seqNameVector[aaI[i][0]];
1833 for(int j=1;j<nSeqsPerOTU[i];j++){
1834 nameFile << ',' << seqNameVector[aaI[i][j]];
1841 outputNames.push_back(nameFileName); outputTypes["name"].push_back(nameFileName);
1844 if(compositeNamesFileName != ""){
1845 m->appendFiles(nameFileName, compositeNamesFileName);
1848 catch(exception& e) {
1849 m->errorOut(e, "ShhherCommand", "writeNames");
1854 /**************************************************************************************************/
1856 void ShhherCommand::writeGroups(){
1858 string thisOutputDir = outputDir;
1859 if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
1860 string fileRoot = m->getRootName(m->getSimpleName(flowFileName));
1861 int pos = fileRoot.find_first_of('.');
1862 string fileGroup = fileRoot;
1863 if (pos != string::npos) { fileGroup = fileRoot.substr(pos+1, (fileRoot.length()-1-(pos+1))); }
1864 map<string, string> variables;
1865 variables["[filename]"] = thisOutputDir + fileRoot;
1866 string groupFileName = getOutputFileName("group",variables);
1868 m->openOutputFile(groupFileName, groupFile);
1870 for(int i=0;i<numSeqs;i++){
1871 if (m->control_pressed) { break; }
1872 groupFile << seqNameVector[i] << '\t' << fileGroup << endl;
1875 outputNames.push_back(groupFileName); outputTypes["group"].push_back(groupFileName);
1878 catch(exception& e) {
1879 m->errorOut(e, "ShhherCommand", "writeGroups");
1884 /**************************************************************************************************/
1886 void ShhherCommand::writeClusters(vector<int> otuCounts){
1888 string thisOutputDir = outputDir;
1889 if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
1890 map<string, string> variables;
1891 variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
1892 string otuCountsFileName = getOutputFileName("counts",variables);
1893 ofstream otuCountsFile;
1894 m->openOutputFile(otuCountsFileName, otuCountsFile);
1896 string bases = flowOrder;
1898 for(int i=0;i<numOTUs;i++){
1900 if (m->control_pressed) {
1903 //output the translated version of the centroid sequence for the otu
1904 if(otuCounts[i] > 0){
1905 int index = centroids[i];
1907 otuCountsFile << "ideal\t";
1908 for(int j=8;j<numFlowCells;j++){
1909 char base = bases[j % bases.length()];
1910 for(int s=0;s<uniqueFlowgrams[index * numFlowCells + j];s++){
1911 otuCountsFile << base;
1914 otuCountsFile << endl;
1916 for(int j=0;j<nSeqsPerOTU[i];j++){
1917 int sequence = aaI[i][j];
1918 otuCountsFile << seqNameVector[sequence] << '\t';
1922 for(int k=0;k<lengths[sequence];k++){
1923 char base = bases[k % bases.length()];
1924 int freq = int(0.01 * (double)flowDataIntI[sequence * numFlowCells + k] + 0.5);
1926 for(int s=0;s<freq;s++){
1928 //otuCountsFile << base;
1931 otuCountsFile << newSeq.substr(4) << endl;
1933 otuCountsFile << endl;
1936 otuCountsFile.close();
1937 outputNames.push_back(otuCountsFileName); outputTypes["counts"].push_back(otuCountsFileName);
1940 catch(exception& e) {
1941 m->errorOut(e, "ShhherCommand", "writeClusters");
1947 //**********************************************************************************************************************
1949 int ShhherCommand::execute(){
1951 if (abort == true) { if (calledHelp) { return 0; } return 2; }
1953 getSingleLookUp(); if (m->control_pressed) { return 0; }
1954 getJointLookUp(); if (m->control_pressed) { return 0; }
1956 int numFiles = flowFileVector.size();
1958 if (numFiles < processors) { processors = numFiles; }
1960 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
1961 if (processors == 1) { driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName); }
1962 else { createProcesses(flowFileVector); } //each processor processes one file
1964 driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName);
1967 if(compositeFASTAFileName != ""){
1968 outputNames.push_back(compositeFASTAFileName); outputTypes["fasta"].push_back(compositeFASTAFileName);
1969 outputNames.push_back(compositeNamesFileName); outputTypes["name"].push_back(compositeNamesFileName);
1972 m->mothurOutEndLine();
1973 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
1974 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
1975 m->mothurOutEndLine();
1979 catch(exception& e) {
1980 m->errorOut(e, "ShhherCommand", "execute");
1985 //********************************************************************************************************************
1986 //sorts biggest to smallest
1987 inline bool compareFileSizes(string left, string right){
1992 //get num bytes in file
1993 string filename = left;
1994 pFile = fopen (filename.c_str(),"rb");
1995 string error = "Error opening " + filename;
1996 if (pFile==NULL) perror (error.c_str());
1998 fseek (pFile, 0, SEEK_END);
1999 leftsize=ftell (pFile);
2006 //get num bytes in file
2008 pFile2 = fopen (filename.c_str(),"rb");
2009 error = "Error opening " + filename;
2010 if (pFile2==NULL) perror (error.c_str());
2012 fseek (pFile2, 0, SEEK_END);
2013 rightsize=ftell (pFile2);
2017 return (leftsize > rightsize);
2019 /**************************************************************************************************/
2021 int ShhherCommand::createProcesses(vector<string> filenames){
2023 vector<int> processIDS;
2028 if (filenames.size() < processors) { processors = filenames.size(); }
2030 //sort file names by size to divide load better
2031 sort(filenames.begin(), filenames.end(), compareFileSizes);
2033 vector < vector <string> > dividedFiles; //dividedFiles[1] = vector of filenames for process 1...
2034 dividedFiles.resize(processors);
2036 //for each file, figure out which process will complete it
2037 //want to divide the load intelligently so the big files are spread between processes
2038 for (int i = 0; i < filenames.size(); i++) {
2039 int processToAssign = (i+1) % processors;
2040 if (processToAssign == 0) { processToAssign = processors; }
2042 dividedFiles[(processToAssign-1)].push_back(filenames[i]);
2045 //now lets reverse the order of ever other process, so we balance big files running with little ones
2046 for (int i = 0; i < processors; i++) {
2047 int remainder = ((i+1) % processors);
2048 if (remainder) { reverse(dividedFiles[i].begin(), dividedFiles[i].end()); }
2052 //divide the groups between the processors
2053 /*vector<linePair> lines;
2054 vector<int> numFilesToComplete;
2055 int numFilesPerProcessor = filenames.size() / processors;
2056 for (int i = 0; i < processors; i++) {
2057 int startIndex = i * numFilesPerProcessor;
2058 int endIndex = (i+1) * numFilesPerProcessor;
2059 if(i == (processors - 1)){ endIndex = filenames.size(); }
2060 lines.push_back(linePair(startIndex, endIndex));
2061 numFilesToComplete.push_back((endIndex-startIndex));
2064 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
2066 //loop through and create all the processes you want
2067 while (process != processors) {
2071 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
2073 }else if (pid == 0){
2074 num = driver(dividedFiles[process], compositeFASTAFileName + toString(getpid()) + ".temp", compositeNamesFileName + toString(getpid()) + ".temp");
2076 //pass numSeqs to parent
2078 string tempFile = compositeFASTAFileName + toString(getpid()) + ".num.temp";
2079 m->openOutputFile(tempFile, out);
2085 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
2086 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
2092 driver(dividedFiles[0], compositeFASTAFileName, compositeNamesFileName);
2094 //force parent to wait until all the processes are done
2095 for (int i=0;i<processIDS.size();i++) {
2096 int temp = processIDS[i];
2102 //////////////////////////////////////////////////////////////////////////////////////////////////////
2104 /////////////////////// NOT WORKING, ACCESS VIOLATION ON READ OF FLOWGRAMS IN THREAD /////////////////
2106 //////////////////////////////////////////////////////////////////////////////////////////////////////
2107 //Windows version shared memory, so be careful when passing variables through the shhhFlowsData struct.
2108 //Above fork() will clone, so memory is separate, but that's not the case with windows,
2109 //////////////////////////////////////////////////////////////////////////////////////////////////////
2111 vector<shhhFlowsData*> pDataArray;
2112 DWORD dwThreadIdArray[processors-1];
2113 HANDLE hThreadArray[processors-1];
2115 //Create processor worker threads.
2116 for( int i=0; i<processors-1; i++ ){
2117 // Allocate memory for thread data.
2118 string extension = "";
2119 if (i != 0) { extension = toString(i) + ".temp"; }
2121 shhhFlowsData* tempFlow = new shhhFlowsData(filenames, (compositeFASTAFileName + extension), (compositeNamesFileName + extension), outputDir, flowOrder, jointLookUp, singleLookUp, m, lines[i].start, lines[i].end, cutoff, sigma, minDelta, maxIters, i);
2122 pDataArray.push_back(tempFlow);
2123 processIDS.push_back(i);
2125 hThreadArray[i] = CreateThread(NULL, 0, ShhhFlowsThreadFunction, pDataArray[i], 0, &dwThreadIdArray[i]);
2128 //using the main process as a worker saves time and memory
2130 driver(filenames, compositeFASTAFileName, compositeNamesFileName, lines[processors-1].start, lines[processors-1].end);
2132 //Wait until all threads have terminated.
2133 WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
2135 //Close all thread handles and free memory allocations.
2136 for(int i=0; i < pDataArray.size(); i++){
2137 for(int j=0; j < pDataArray[i]->outputNames.size(); j++){ outputNames.push_back(pDataArray[i]->outputNames[j]); }
2138 CloseHandle(hThreadArray[i]);
2139 delete pDataArray[i];
2144 for (int i=0;i<processIDS.size();i++) {
2146 string tempFile = compositeFASTAFileName + toString(processIDS[i]) + ".num.temp";
2147 m->openInputFile(tempFile, in);
2151 if (tempNum != dividedFiles[i+1].size()) {
2152 m->mothurOut("[ERROR]: main process expected " + toString(processIDS[i]) + " to complete " + toString(dividedFiles[i+1].size()) + " files, and it only reported completing " + toString(tempNum) + ". This will cause file mismatches. The flow files may be too large to process with multiple processors. \n");
2155 in.close(); m->mothurRemove(tempFile);
2157 if (compositeFASTAFileName != "") {
2158 m->appendFiles((compositeFASTAFileName + toString(processIDS[i]) + ".temp"), compositeFASTAFileName);
2159 m->appendFiles((compositeNamesFileName + toString(processIDS[i]) + ".temp"), compositeNamesFileName);
2160 m->mothurRemove((compositeFASTAFileName + toString(processIDS[i]) + ".temp"));
2161 m->mothurRemove((compositeNamesFileName + toString(processIDS[i]) + ".temp"));
2168 catch(exception& e) {
2169 m->errorOut(e, "ShhherCommand", "createProcesses");
2173 /**************************************************************************************************/
2175 vector<string> ShhherCommand::parseFlowFiles(string filename){
2177 vector<string> files;
2181 m->openInputFile(filename, in);
2183 int thisNumFLows = 0;
2184 in >> thisNumFLows; m->gobble(in);
2187 if (m->control_pressed) { break; }
2190 string outputFileName = filename + toString(count) + ".temp";
2191 m->openOutputFile(outputFileName, out);
2192 out << thisNumFLows << endl;
2193 files.push_back(outputFileName);
2195 int numLinesWrote = 0;
2196 for (int i = 0; i < largeSize; i++) {
2197 if (in.eof()) { break; }
2198 string line = m->getline(in); m->gobble(in);
2199 out << line << endl;
2204 if (numLinesWrote == 0) { m->mothurRemove(outputFileName); files.pop_back(); }
2209 if (m->control_pressed) { for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); } files.clear(); }
2211 m->mothurOut("\nDivided " + filename + " into " + toString(files.size()) + " files.\n\n");
2215 catch(exception& e) {
2216 m->errorOut(e, "ShhherCommand", "parseFlowFiles");
2220 /**************************************************************************************************/
2222 int ShhherCommand::driver(vector<string> filenames, string thisCompositeFASTAFileName, string thisCompositeNamesFileName){
2225 int numCompleted = 0;
2227 for(int i=0;i<filenames.size();i++){
2229 if (m->control_pressed) { break; }
2231 vector<string> theseFlowFileNames; theseFlowFileNames.push_back(filenames[i]);
2232 if (large) { theseFlowFileNames = parseFlowFiles(filenames[i]); }
2234 if (m->control_pressed) { break; }
2236 double begClock = clock();
2237 unsigned long long begTime;
2239 for (int g = 0; g < theseFlowFileNames.size(); g++) {
2241 string flowFileName = theseFlowFileNames[g];
2242 m->mothurOut("\n>>>>>\tProcessing " + flowFileName + " (file " + toString(i+1) + " of " + toString(filenames.size()) + ")\t<<<<<\n");
2243 m->mothurOut("Reading flowgrams...\n");
2245 vector<string> seqNameVector;
2246 vector<int> lengths;
2247 vector<short> flowDataIntI;
2248 vector<double> flowDataPrI;
2249 map<string, int> nameMap;
2250 vector<short> uniqueFlowgrams;
2251 vector<int> uniqueCount;
2252 vector<int> mapSeqToUnique;
2253 vector<int> mapUniqueToSeq;
2254 vector<int> uniqueLengths;
2257 if (m->debug) { m->mothurOut("[DEBUG]: About to read flowgrams.\n"); }
2258 int numSeqs = getFlowData(flowFileName, seqNameVector, lengths, flowDataIntI, nameMap, numFlowCells);
2260 if (m->control_pressed) { break; }
2262 m->mothurOut("Identifying unique flowgrams...\n");
2263 int numUniques = getUniques(numSeqs, numFlowCells, uniqueFlowgrams, uniqueCount, uniqueLengths, mapSeqToUnique, mapUniqueToSeq, lengths, flowDataPrI, flowDataIntI);
2265 if (m->control_pressed) { break; }
2267 m->mothurOut("Calculating distances between flowgrams...\n");
2268 string distFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.dist";
2269 begTime = time(NULL);
2272 flowDistParentFork(numFlowCells, distFileName, numUniques, mapUniqueToSeq, mapSeqToUnique, lengths, flowDataPrI, flowDataIntI);
2274 m->mothurOutEndLine();
2275 m->mothurOut("Total time: " + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/CLOCKS_PER_SEC) + '\n');
2278 string namesFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.names";
2279 createNamesFile(numSeqs, numUniques, namesFileName, seqNameVector, mapSeqToUnique, mapUniqueToSeq);
2281 if (m->control_pressed) { break; }
2283 m->mothurOut("\nClustering flowgrams...\n");
2284 string listFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.list";
2285 cluster(listFileName, distFileName, namesFileName);
2287 if (m->control_pressed) { break; }
2289 vector<int> otuData;
2290 vector<int> cumNumSeqs;
2291 vector<int> nSeqsPerOTU;
2292 vector<vector<int> > aaP; //tMaster->aanP: each row is a different otu / each col contains the sequence indices
2293 vector<vector<int> > aaI; //tMaster->aanI: that are in each otu - can't differentiate between aaP and aaI
2294 vector<int> seqNumber; //tMaster->anP: the sequence id number sorted by OTU
2295 vector<int> seqIndex; //tMaster->anI; the index that corresponds to seqNumber
2298 int numOTUs = getOTUData(numSeqs, listFileName, otuData, cumNumSeqs, nSeqsPerOTU, aaP, aaI, seqNumber, seqIndex, nameMap);
2300 if (m->control_pressed) { break; }
2302 m->mothurRemove(distFileName);
2303 m->mothurRemove(namesFileName);
2304 m->mothurRemove(listFileName);
2306 vector<double> dist; //adDist - distance of sequences to centroids
2307 vector<short> change; //did the centroid sequence change? 0 = no; 1 = yes
2308 vector<int> centroids; //the representative flowgram for each cluster m
2309 vector<double> weight;
2310 vector<double> singleTau; //tMaster->adTau: 1-D Tau vector (1xnumSeqs)
2311 vector<int> nSeqsBreaks;
2312 vector<int> nOTUsBreaks;
2314 if (m->debug) { m->mothurOut("[DEBUG]: numSeqs = " + toString(numSeqs) + " numOTUS = " + toString(numOTUs) + " about to alloc a dist vector with size = " + toString((numSeqs * numOTUs)) + ".\n"); }
2316 dist.assign(numSeqs * numOTUs, 0);
2317 change.assign(numOTUs, 1);
2318 centroids.assign(numOTUs, -1);
2319 weight.assign(numOTUs, 0);
2320 singleTau.assign(numSeqs, 1.0);
2322 nSeqsBreaks.assign(2, 0);
2323 nOTUsBreaks.assign(2, 0);
2326 nSeqsBreaks[1] = numSeqs;
2327 nOTUsBreaks[1] = numOTUs;
2329 if (m->debug) { m->mothurOut("[DEBUG]: done allocating memory, about to denoise.\n"); }
2331 if (m->control_pressed) { break; }
2333 double maxDelta = 0;
2337 begTime = time(NULL);
2339 m->mothurOut("\nDenoising flowgrams...\n");
2340 m->mothurOut("iter\tmaxDelta\tnLL\t\tcycletime\n");
2342 while((maxIters == 0 && maxDelta > minDelta) || iter < MIN_ITER || (maxDelta > minDelta && iter < maxIters)){
2344 if (m->control_pressed) { break; }
2346 double cycClock = clock();
2347 unsigned long long cycTime = time(NULL);
2348 fill(numOTUs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, aaP, aaI);
2350 if (m->control_pressed) { break; }
2352 calcCentroidsDriver(numOTUs, cumNumSeqs, nSeqsPerOTU, seqIndex, change, centroids, singleTau, mapSeqToUnique, uniqueFlowgrams, flowDataIntI, lengths, numFlowCells, seqNumber);
2354 if (m->control_pressed) { break; }
2356 maxDelta = getNewWeights(numOTUs, cumNumSeqs, nSeqsPerOTU, singleTau, seqNumber, weight);
2358 if (m->control_pressed) { break; }
2360 double nLL = getLikelihood(numSeqs, numOTUs, nSeqsPerOTU, seqNumber, cumNumSeqs, seqIndex, dist, weight);
2362 if (m->control_pressed) { break; }
2364 checkCentroids(numOTUs, centroids, weight);
2366 if (m->control_pressed) { break; }
2368 calcNewDistances(numSeqs, numOTUs, nSeqsPerOTU, dist, weight, change, centroids, aaP, singleTau, aaI, seqNumber, seqIndex, uniqueFlowgrams, flowDataIntI, numFlowCells, lengths);
2370 if (m->control_pressed) { break; }
2374 m->mothurOut(toString(iter) + '\t' + toString(maxDelta) + '\t' + toString(nLL) + '\t' + toString(time(NULL) - cycTime) + '\t' + toString((clock() - cycClock)/(double)CLOCKS_PER_SEC) + '\n');
2378 if (m->control_pressed) { break; }
2380 m->mothurOut("\nFinalizing...\n");
2381 fill(numOTUs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, aaP, aaI);
2383 if (m->control_pressed) { break; }
2385 setOTUs(numOTUs, numSeqs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, otuData, singleTau, dist, aaP, aaI);
2387 if (m->control_pressed) { break; }
2389 vector<int> otuCounts(numOTUs, 0);
2390 for(int j=0;j<numSeqs;j++) { otuCounts[otuData[j]]++; }
2392 calcCentroidsDriver(numOTUs, cumNumSeqs, nSeqsPerOTU, seqIndex, change, centroids, singleTau, mapSeqToUnique, uniqueFlowgrams, flowDataIntI, lengths, numFlowCells, seqNumber);
2394 if (m->control_pressed) { break; }
2396 if ((large) && (g == 0)) { flowFileName = filenames[i]; theseFlowFileNames[0] = filenames[i]; }
2397 string thisOutputDir = outputDir;
2398 if (outputDir == "") { thisOutputDir = m->hasPath(flowFileName); }
2399 map<string, string> variables;
2400 variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
2401 string qualityFileName = getOutputFileName("qfile",variables);
2402 string fastaFileName = getOutputFileName("fasta",variables);
2403 string nameFileName = getOutputFileName("name",variables);
2404 string otuCountsFileName = getOutputFileName("counts",variables);
2405 string fileRoot = m->getRootName(m->getSimpleName(flowFileName));
2406 int pos = fileRoot.find_first_of('.');
2407 string fileGroup = fileRoot;
2408 if (pos != string::npos) { fileGroup = fileRoot.substr(pos+1, (fileRoot.length()-1-(pos+1))); }
2409 string groupFileName = getOutputFileName("group",variables);
2412 writeQualities(numOTUs, numFlowCells, qualityFileName, otuCounts, nSeqsPerOTU, seqNumber, singleTau, flowDataIntI, uniqueFlowgrams, cumNumSeqs, mapUniqueToSeq, seqNameVector, centroids, aaI); if (m->control_pressed) { break; }
2413 writeSequences(thisCompositeFASTAFileName, numOTUs, numFlowCells, fastaFileName, otuCounts, uniqueFlowgrams, seqNameVector, aaI, centroids);if (m->control_pressed) { break; }
2414 writeNames(thisCompositeNamesFileName, numOTUs, nameFileName, otuCounts, seqNameVector, aaI, nSeqsPerOTU); if (m->control_pressed) { break; }
2415 writeClusters(otuCountsFileName, numOTUs, numFlowCells,otuCounts, centroids, uniqueFlowgrams, seqNameVector, aaI, nSeqsPerOTU, lengths, flowDataIntI); if (m->control_pressed) { break; }
2416 writeGroups(groupFileName, fileGroup, numSeqs, seqNameVector); if (m->control_pressed) { break; }
2420 variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0]));
2421 m->appendFiles(qualityFileName, getOutputFileName("qfile",variables));
2422 m->mothurRemove(qualityFileName);
2423 m->appendFiles(fastaFileName, getOutputFileName("fasta",variables));
2424 m->mothurRemove(fastaFileName);
2425 m->appendFiles(nameFileName, getOutputFileName("name",variables));
2426 m->mothurRemove(nameFileName);
2427 m->appendFiles(otuCountsFileName, getOutputFileName("counts",variables));
2428 m->mothurRemove(otuCountsFileName);
2429 m->appendFiles(groupFileName, getOutputFileName("group",variables));
2430 m->mothurRemove(groupFileName);
2432 m->mothurRemove(theseFlowFileNames[g]);
2437 m->mothurOut("Total time to process " + flowFileName + ":\t" + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/(double)CLOCKS_PER_SEC) + '\n');
2440 if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; }
2442 return numCompleted;
2444 }catch(exception& e) {
2445 m->errorOut(e, "ShhherCommand", "driver");
2450 /**************************************************************************************************/
2451 int ShhherCommand::getFlowData(string filename, vector<string>& thisSeqNameVector, vector<int>& thisLengths, vector<short>& thisFlowDataIntI, map<string, int>& thisNameMap, int& numFlowCells){
2456 m->openInputFile(filename, flowFile);
2459 int currentNumFlowCells;
2461 thisSeqNameVector.clear();
2462 thisLengths.clear();
2463 thisFlowDataIntI.clear();
2464 thisNameMap.clear();
2467 flowFile >> numFlowTest;
2469 if (!m->isContainingOnlyDigits(numFlowTest)) { m->mothurOut("[ERROR]: expected a number and got " + numFlowTest + ", quitting. Did you use the flow parameter instead of the file parameter?"); m->mothurOutEndLine(); exit(1); }
2470 else { convert(numFlowTest, numFlowCells); }
2472 if (m->debug) { m->mothurOut("[DEBUG]: numFlowCells = " + toString(numFlowCells) + ".\n"); }
2473 int index = 0;//pcluster
2474 while(!flowFile.eof()){
2476 if (m->control_pressed) { break; }
2478 flowFile >> seqName >> currentNumFlowCells;
2480 thisLengths.push_back(currentNumFlowCells);
2482 thisSeqNameVector.push_back(seqName);
2483 thisNameMap[seqName] = index++;//pcluster
2485 if (m->debug) { m->mothurOut("[DEBUG]: seqName = " + seqName + " length = " + toString(currentNumFlowCells) + " index = " + toString(index) + "\n"); }
2487 for(int i=0;i<numFlowCells;i++){
2488 flowFile >> intensity;
2489 if(intensity > 9.99) { intensity = 9.99; }
2490 int intI = int(100 * intensity + 0.0001);
2491 thisFlowDataIntI.push_back(intI);
2493 m->gobble(flowFile);
2497 int numSeqs = thisSeqNameVector.size();
2499 for(int i=0;i<numSeqs;i++){
2501 if (m->control_pressed) { break; }
2503 int iNumFlowCells = i * numFlowCells;
2504 for(int j=thisLengths[i];j<numFlowCells;j++){
2505 thisFlowDataIntI[iNumFlowCells + j] = 0;
2512 catch(exception& e) {
2513 m->errorOut(e, "ShhherCommand", "getFlowData");
2517 /**************************************************************************************************/
2519 int ShhherCommand::flowDistParentFork(int numFlowCells, string distFileName, int stopSeq, vector<int>& mapUniqueToSeq, vector<int>& mapSeqToUnique, vector<int>& lengths, vector<double>& flowDataPrI, vector<short>& flowDataIntI){
2522 ostringstream outStream;
2523 outStream.setf(ios::fixed, ios::floatfield);
2524 outStream.setf(ios::dec, ios::basefield);
2525 outStream.setf(ios::showpoint);
2526 outStream.precision(6);
2528 int begTime = time(NULL);
2529 double begClock = clock();
2531 for(int i=0;i<stopSeq;i++){
2533 if (m->control_pressed) { break; }
2535 for(int j=0;j<i;j++){
2536 float flowDistance = calcPairwiseDist(numFlowCells, mapUniqueToSeq[i], mapUniqueToSeq[j], mapSeqToUnique, lengths, flowDataPrI, flowDataIntI);
2538 if(flowDistance < 1e-6){
2539 outStream << mapUniqueToSeq[i] << '\t' << mapUniqueToSeq[j] << '\t' << 0.000000 << endl;
2541 else if(flowDistance <= cutoff){
2542 outStream << mapUniqueToSeq[i] << '\t' << mapUniqueToSeq[j] << '\t' << flowDistance << endl;
2546 m->mothurOut(toString(i) + "\t" + toString(time(NULL) - begTime));
2547 m->mothurOut("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC));
2548 m->mothurOutEndLine();
2552 ofstream distFile(distFileName.c_str());
2553 distFile << outStream.str();
2556 if (m->control_pressed) {}
2558 m->mothurOut(toString(stopSeq-1) + "\t" + toString(time(NULL) - begTime));
2559 m->mothurOut("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC));
2560 m->mothurOutEndLine();
2565 catch(exception& e) {
2566 m->errorOut(e, "ShhherCommand", "flowDistParentFork");
2570 /**************************************************************************************************/
2572 float ShhherCommand::calcPairwiseDist(int numFlowCells, int seqA, int seqB, vector<int>& mapSeqToUnique, vector<int>& lengths, vector<double>& flowDataPrI, vector<short>& flowDataIntI){
2574 int minLength = lengths[mapSeqToUnique[seqA]];
2575 if(lengths[seqB] < minLength){ minLength = lengths[mapSeqToUnique[seqB]]; }
2577 int ANumFlowCells = seqA * numFlowCells;
2578 int BNumFlowCells = seqB * numFlowCells;
2582 for(int i=0;i<minLength;i++){
2584 if (m->control_pressed) { break; }
2586 int flowAIntI = flowDataIntI[ANumFlowCells + i];
2587 float flowAPrI = flowDataPrI[ANumFlowCells + i];
2589 int flowBIntI = flowDataIntI[BNumFlowCells + i];
2590 float flowBPrI = flowDataPrI[BNumFlowCells + i];
2591 dist += jointLookUp[flowAIntI * NUMBINS + flowBIntI] - flowAPrI - flowBPrI;
2594 dist /= (float) minLength;
2597 catch(exception& e) {
2598 m->errorOut(e, "ShhherCommand", "calcPairwiseDist");
2603 /**************************************************************************************************/
2605 int ShhherCommand::getUniques(int numSeqs, int numFlowCells, vector<short>& uniqueFlowgrams, vector<int>& uniqueCount, vector<int>& uniqueLengths, vector<int>& mapSeqToUnique, vector<int>& mapUniqueToSeq, vector<int>& lengths, vector<double>& flowDataPrI, vector<short>& flowDataIntI){
2608 uniqueFlowgrams.assign(numFlowCells * numSeqs, -1);
2609 uniqueCount.assign(numSeqs, 0); // anWeights
2610 uniqueLengths.assign(numSeqs, 0);
2611 mapSeqToUnique.assign(numSeqs, -1);
2612 mapUniqueToSeq.assign(numSeqs, -1);
2614 vector<short> uniqueFlowDataIntI(numFlowCells * numSeqs, -1);
2616 for(int i=0;i<numSeqs;i++){
2618 if (m->control_pressed) { break; }
2622 vector<short> current(numFlowCells);
2623 for(int j=0;j<numFlowCells;j++){
2624 current[j] = short(((flowDataIntI[i * numFlowCells + j] + 50.0)/100.0));
2627 for(int j=0;j<numUniques;j++){
2628 int offset = j * numFlowCells;
2632 if(lengths[i] < uniqueLengths[j]) { shorterLength = lengths[i]; }
2633 else { shorterLength = uniqueLengths[j]; }
2635 for(int k=0;k<shorterLength;k++){
2636 if(current[k] != uniqueFlowgrams[offset + k]){
2643 mapSeqToUnique[i] = j;
2646 if(lengths[i] > uniqueLengths[j]) { uniqueLengths[j] = lengths[i]; }
2652 if(index == numUniques){
2653 uniqueLengths[numUniques] = lengths[i];
2654 uniqueCount[numUniques] = 1;
2655 mapSeqToUnique[i] = numUniques;//anMap
2656 mapUniqueToSeq[numUniques] = i;//anF
2658 for(int k=0;k<numFlowCells;k++){
2659 uniqueFlowgrams[numUniques * numFlowCells + k] = current[k];
2660 uniqueFlowDataIntI[numUniques * numFlowCells + k] = flowDataIntI[i * numFlowCells + k];
2666 uniqueFlowDataIntI.resize(numFlowCells * numUniques);
2667 uniqueLengths.resize(numUniques);
2669 flowDataPrI.resize(numSeqs * numFlowCells, 0);
2670 for(int i=0;i<flowDataPrI.size();i++) { if (m->control_pressed) { break; } flowDataPrI[i] = getProbIntensity(flowDataIntI[i]); }
2674 catch(exception& e) {
2675 m->errorOut(e, "ShhherCommand", "getUniques");
2679 /**************************************************************************************************/
2680 int ShhherCommand::createNamesFile(int numSeqs, int numUniques, string filename, vector<string>& seqNameVector, vector<int>& mapSeqToUnique, vector<int>& mapUniqueToSeq){
2683 vector<string> duplicateNames(numUniques, "");
2684 for(int i=0;i<numSeqs;i++){
2685 duplicateNames[mapSeqToUnique[i]] += seqNameVector[i] + ',';
2689 m->openOutputFile(filename, nameFile);
2691 for(int i=0;i<numUniques;i++){
2693 if (m->control_pressed) { break; }
2695 // nameFile << seqNameVector[mapUniqueToSeq[i]] << '\t' << duplicateNames[i].substr(0, duplicateNames[i].find_last_of(',')) << endl;
2696 nameFile << mapUniqueToSeq[i] << '\t' << duplicateNames[i].substr(0, duplicateNames[i].find_last_of(',')) << endl;
2703 catch(exception& e) {
2704 m->errorOut(e, "ShhherCommand", "createNamesFile");
2708 //**********************************************************************************************************************
2710 int ShhherCommand::cluster(string filename, string distFileName, string namesFileName){
2713 ReadMatrix* read = new ReadColumnMatrix(distFileName);
2714 read->setCutoff(cutoff);
2716 NameAssignment* clusterNameMap = new NameAssignment(namesFileName);
2717 clusterNameMap->readMap();
2718 read->read(clusterNameMap);
2720 ListVector* list = read->getListVector();
2721 SparseDistanceMatrix* matrix = read->getDMatrix();
2724 delete clusterNameMap;
2726 RAbundVector* rabund = new RAbundVector(list->getRAbundVector());
2728 Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest");
2729 string tag = cluster->getTag();
2731 double clusterCutoff = cutoff;
2732 while (matrix->getSmallDist() <= clusterCutoff && matrix->getNNodes() > 0){
2734 if (m->control_pressed) { break; }
2736 cluster->update(clusterCutoff);
2739 list->setLabel(toString(cutoff));
2742 m->openOutputFile(filename, listFile);
2743 list->print(listFile);
2746 delete matrix; delete cluster; delete rabund; delete list;
2750 catch(exception& e) {
2751 m->errorOut(e, "ShhherCommand", "cluster");
2755 /**************************************************************************************************/
2757 int ShhherCommand::getOTUData(int numSeqs, string fileName, vector<int>& otuData,
2758 vector<int>& cumNumSeqs,
2759 vector<int>& nSeqsPerOTU,
2760 vector<vector<int> >& aaP, //tMaster->aanP: each row is a different otu / each col contains the sequence indices
2761 vector<vector<int> >& aaI, //tMaster->aanI: that are in each otu - can't differentiate between aaP and aaI
2762 vector<int>& seqNumber, //tMaster->anP: the sequence id number sorted by OTU
2763 vector<int>& seqIndex,
2764 map<string, int>& nameMap){
2768 m->openInputFile(fileName, listFile);
2772 listFile >> label >> numOTUs;
2774 if (m->debug) { m->mothurOut("[DEBUG]: Getting OTU Data...\n"); }
2776 otuData.assign(numSeqs, 0);
2777 cumNumSeqs.assign(numOTUs, 0);
2778 nSeqsPerOTU.assign(numOTUs, 0);
2779 aaP.clear();aaP.resize(numOTUs);
2785 string singleOTU = "";
2787 for(int i=0;i<numOTUs;i++){
2789 if (m->control_pressed) { break; }
2790 if (m->debug) { m->mothurOut("[DEBUG]: processing OTU " + toString(i) + ".\n"); }
2792 listFile >> singleOTU;
2794 istringstream otuString(singleOTU);
2798 string seqName = "";
2800 for(int j=0;j<singleOTU.length();j++){
2801 char letter = otuString.get();
2807 map<string,int>::iterator nmIt = nameMap.find(seqName);
2808 int index = nmIt->second;
2810 nameMap.erase(nmIt);
2814 aaP[i].push_back(index);
2819 map<string,int>::iterator nmIt = nameMap.find(seqName);
2821 int index = nmIt->second;
2822 nameMap.erase(nmIt);
2826 aaP[i].push_back(index);
2831 sort(aaP[i].begin(), aaP[i].end());
2832 for(int j=0;j<nSeqsPerOTU[i];j++){
2833 seqNumber.push_back(aaP[i][j]);
2835 for(int j=nSeqsPerOTU[i];j<numSeqs;j++){
2836 aaP[i].push_back(0);
2842 for(int i=1;i<numOTUs;i++){
2843 cumNumSeqs[i] = cumNumSeqs[i-1] + nSeqsPerOTU[i-1];
2846 seqIndex = seqNumber;
2853 catch(exception& e) {
2854 m->errorOut(e, "ShhherCommand", "getOTUData");
2858 /**************************************************************************************************/
2860 int ShhherCommand::calcCentroidsDriver(int numOTUs,
2861 vector<int>& cumNumSeqs,
2862 vector<int>& nSeqsPerOTU,
2863 vector<int>& seqIndex,
2864 vector<short>& change, //did the centroid sequence change? 0 = no; 1 = yes
2865 vector<int>& centroids, //the representative flowgram for each cluster m
2866 vector<double>& singleTau, //tMaster->adTau: 1-D Tau vector (1xnumSeqs)
2867 vector<int>& mapSeqToUnique,
2868 vector<short>& uniqueFlowgrams,
2869 vector<short>& flowDataIntI,
2870 vector<int>& lengths,
2872 vector<int>& seqNumber){
2874 //this function gets the most likely homopolymer length at a flow position for a group of sequences
2879 for(int i=0;i<numOTUs;i++){
2881 if (m->control_pressed) { break; }
2885 int minFlowGram = 100000000;
2886 double minFlowValue = 1e8;
2887 change[i] = 0; //FALSE
2889 for(int j=0;j<nSeqsPerOTU[i];j++){
2890 count += singleTau[seqNumber[cumNumSeqs[i] + j]];
2893 if(nSeqsPerOTU[i] > 0 && count > MIN_COUNT){
2894 vector<double> adF(nSeqsPerOTU[i]);
2895 vector<int> anL(nSeqsPerOTU[i]);
2897 for(int j=0;j<nSeqsPerOTU[i];j++){
2898 int index = cumNumSeqs[i] + j;
2899 int nI = seqIndex[index];
2900 int nIU = mapSeqToUnique[nI];
2903 for(k=0;k<position;k++){
2909 anL[position] = nIU;
2910 adF[position] = 0.0000;
2915 for(int j=0;j<nSeqsPerOTU[i];j++){
2916 int index = cumNumSeqs[i] + j;
2917 int nI = seqIndex[index];
2919 double tauValue = singleTau[seqNumber[index]];
2921 for(int k=0;k<position;k++){
2922 double dist = getDistToCentroid(anL[k], nI, lengths[nI], uniqueFlowgrams, flowDataIntI, numFlowCells);
2923 adF[k] += dist * tauValue;
2927 for(int j=0;j<position;j++){
2928 if(adF[j] < minFlowValue){
2930 minFlowValue = adF[j];
2934 if(centroids[i] != anL[minFlowGram]){
2936 centroids[i] = anL[minFlowGram];
2939 else if(centroids[i] != -1){
2947 catch(exception& e) {
2948 m->errorOut(e, "ShhherCommand", "calcCentroidsDriver");
2952 /**************************************************************************************************/
2954 double ShhherCommand::getDistToCentroid(int cent, int flow, int length, vector<short>& uniqueFlowgrams,
2955 vector<short>& flowDataIntI, int numFlowCells){
2958 int flowAValue = cent * numFlowCells;
2959 int flowBValue = flow * numFlowCells;
2963 for(int i=0;i<length;i++){
2964 dist += singleLookUp[uniqueFlowgrams[flowAValue] * NUMBINS + flowDataIntI[flowBValue]];
2969 return dist / (double)length;
2971 catch(exception& e) {
2972 m->errorOut(e, "ShhherCommand", "getDistToCentroid");
2976 /**************************************************************************************************/
2978 double ShhherCommand::getNewWeights(int numOTUs, vector<int>& cumNumSeqs, vector<int>& nSeqsPerOTU, vector<double>& singleTau, vector<int>& seqNumber, vector<double>& weight){
2981 double maxChange = 0;
2983 for(int i=0;i<numOTUs;i++){
2985 if (m->control_pressed) { break; }
2987 double difference = weight[i];
2990 for(int j=0;j<nSeqsPerOTU[i];j++){
2991 int index = cumNumSeqs[i] + j;
2992 double tauValue = singleTau[seqNumber[index]];
2993 weight[i] += tauValue;
2996 difference = fabs(weight[i] - difference);
2997 if(difference > maxChange){ maxChange = difference; }
3001 catch(exception& e) {
3002 m->errorOut(e, "ShhherCommand", "getNewWeights");
3007 /**************************************************************************************************/
3009 double ShhherCommand::getLikelihood(int numSeqs, int numOTUs, vector<int>& nSeqsPerOTU, vector<int>& seqNumber, vector<int>& cumNumSeqs, vector<int>& seqIndex, vector<double>& dist, vector<double>& weight){
3013 vector<long double> P(numSeqs, 0);
3016 for(int i=0;i<numOTUs;i++){
3017 if(weight[i] > MIN_WEIGHT){
3023 for(int i=0;i<numOTUs;i++){
3025 if (m->control_pressed) { break; }
3027 for(int j=0;j<nSeqsPerOTU[i];j++){
3028 int index = cumNumSeqs[i] + j;
3029 int nI = seqIndex[index];
3030 double singleDist = dist[seqNumber[index]];
3032 P[nI] += weight[i] * exp(-singleDist * sigma);
3036 for(int i=0;i<numSeqs;i++){
3037 if(P[i] == 0){ P[i] = DBL_EPSILON; }
3042 nLL = nLL -(double)numSeqs * log(sigma);
3046 catch(exception& e) {
3047 m->errorOut(e, "ShhherCommand", "getNewWeights");
3052 /**************************************************************************************************/
3054 int ShhherCommand::checkCentroids(int numOTUs, vector<int>& centroids, vector<double>& weight){
3056 vector<int> unique(numOTUs, 1);
3058 for(int i=0;i<numOTUs;i++){
3059 if(centroids[i] == -1 || weight[i] < MIN_WEIGHT){
3064 for(int i=0;i<numOTUs;i++){
3066 if (m->control_pressed) { break; }
3069 for(int j=i+1;j<numOTUs;j++){
3072 if(centroids[j] == centroids[i]){
3076 weight[i] += weight[j];
3086 catch(exception& e) {
3087 m->errorOut(e, "ShhherCommand", "checkCentroids");
3091 /**************************************************************************************************/
3093 void ShhherCommand::calcNewDistances(int numSeqs, int numOTUs, vector<int>& nSeqsPerOTU, vector<double>& dist,
3094 vector<double>& weight, vector<short>& change, vector<int>& centroids,
3095 vector<vector<int> >& aaP, vector<double>& singleTau, vector<vector<int> >& aaI,
3096 vector<int>& seqNumber, vector<int>& seqIndex,
3097 vector<short>& uniqueFlowgrams,
3098 vector<short>& flowDataIntI, int numFlowCells, vector<int>& lengths){
3103 vector<double> newTau(numOTUs,0);
3104 vector<double> norms(numSeqs, 0);
3105 nSeqsPerOTU.assign(numOTUs, 0);
3107 for(int i=0;i<numSeqs;i++){
3109 if (m->control_pressed) { break; }
3111 int indexOffset = i * numOTUs;
3113 double offset = 1e8;
3115 for(int j=0;j<numOTUs;j++){
3117 if(weight[j] > MIN_WEIGHT && change[j] == 1){
3118 dist[indexOffset + j] = getDistToCentroid(centroids[j], i, lengths[i], uniqueFlowgrams, flowDataIntI, numFlowCells);
3121 if(weight[j] > MIN_WEIGHT && dist[indexOffset + j] < offset){
3122 offset = dist[indexOffset + j];
3126 for(int j=0;j<numOTUs;j++){
3127 if(weight[j] > MIN_WEIGHT){
3128 newTau[j] = exp(sigma * (-dist[indexOffset + j] + offset)) * weight[j];
3129 norms[i] += newTau[j];
3136 for(int j=0;j<numOTUs;j++){
3137 newTau[j] /= norms[i];
3140 for(int j=0;j<numOTUs;j++){
3141 if(newTau[j] > MIN_TAU){
3143 int oldTotal = total;
3147 singleTau.resize(total, 0);
3148 seqNumber.resize(total, 0);
3149 seqIndex.resize(total, 0);
3151 singleTau[oldTotal] = newTau[j];
3153 aaP[j][nSeqsPerOTU[j]] = oldTotal;
3154 aaI[j][nSeqsPerOTU[j]] = i;
3162 catch(exception& e) {
3163 m->errorOut(e, "ShhherCommand", "calcNewDistances");
3167 /**************************************************************************************************/
3169 int ShhherCommand::fill(int numOTUs, vector<int>& seqNumber, vector<int>& seqIndex, vector<int>& cumNumSeqs, vector<int>& nSeqsPerOTU, vector<vector<int> >& aaP, vector<vector<int> >& aaI){
3172 for(int i=0;i<numOTUs;i++){
3174 if (m->control_pressed) { return 0; }
3176 cumNumSeqs[i] = index;
3177 for(int j=0;j<nSeqsPerOTU[i];j++){
3178 seqNumber[index] = aaP[i][j];
3179 seqIndex[index] = aaI[i][j];
3187 catch(exception& e) {
3188 m->errorOut(e, "ShhherCommand", "fill");
3192 /**************************************************************************************************/
3194 void ShhherCommand::setOTUs(int numOTUs, int numSeqs, vector<int>& seqNumber, vector<int>& seqIndex, vector<int>& cumNumSeqs, vector<int>& nSeqsPerOTU,
3195 vector<int>& otuData, vector<double>& singleTau, vector<double>& dist, vector<vector<int> >& aaP, vector<vector<int> >& aaI){
3198 vector<double> bigTauMatrix(numOTUs * numSeqs, 0.0000);
3200 for(int i=0;i<numOTUs;i++){
3202 if (m->control_pressed) { break; }
3204 for(int j=0;j<nSeqsPerOTU[i];j++){
3205 int index = cumNumSeqs[i] + j;
3206 double tauValue = singleTau[seqNumber[index]];
3207 int sIndex = seqIndex[index];
3208 bigTauMatrix[sIndex * numOTUs + i] = tauValue;
3212 for(int i=0;i<numSeqs;i++){
3213 double maxTau = -1.0000;
3215 for(int j=0;j<numOTUs;j++){
3216 if(bigTauMatrix[i * numOTUs + j] > maxTau){
3217 maxTau = bigTauMatrix[i * numOTUs + j];
3222 otuData[i] = maxOTU;
3225 nSeqsPerOTU.assign(numOTUs, 0);
3227 for(int i=0;i<numSeqs;i++){
3228 int index = otuData[i];
3230 singleTau[i] = 1.0000;
3233 aaP[index][nSeqsPerOTU[index]] = i;
3234 aaI[index][nSeqsPerOTU[index]] = i;
3236 nSeqsPerOTU[index]++;
3239 fill(numOTUs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, aaP, aaI);
3241 catch(exception& e) {
3242 m->errorOut(e, "ShhherCommand", "setOTUs");
3246 /**************************************************************************************************/
3248 void ShhherCommand::writeQualities(int numOTUs, int numFlowCells, string qualityFileName, vector<int> otuCounts, vector<int>& nSeqsPerOTU, vector<int>& seqNumber,
3249 vector<double>& singleTau, vector<short>& flowDataIntI, vector<short>& uniqueFlowgrams, vector<int>& cumNumSeqs,
3250 vector<int>& mapUniqueToSeq, vector<string>& seqNameVector, vector<int>& centroids, vector<vector<int> >& aaI){
3254 ofstream qualityFile;
3255 m->openOutputFile(qualityFileName, qualityFile);
3257 qualityFile.setf(ios::fixed, ios::floatfield);
3258 qualityFile.setf(ios::showpoint);
3259 qualityFile << setprecision(6);
3261 vector<vector<int> > qualities(numOTUs);
3262 vector<double> pr(HOMOPS, 0);
3265 for(int i=0;i<numOTUs;i++){
3267 if (m->control_pressed) { break; }
3272 if(nSeqsPerOTU[i] > 0){
3273 qualities[i].assign(1024, -1);
3275 while(index < numFlowCells){
3276 double maxPrValue = 1e8;
3277 short maxPrIndex = -1;
3278 double count = 0.0000;
3280 pr.assign(HOMOPS, 0);
3282 for(int j=0;j<nSeqsPerOTU[i];j++){
3283 int lIndex = cumNumSeqs[i] + j;
3284 double tauValue = singleTau[seqNumber[lIndex]];
3285 int sequenceIndex = aaI[i][j];
3286 short intensity = flowDataIntI[sequenceIndex * numFlowCells + index];
3290 for(int s=0;s<HOMOPS;s++){
3291 pr[s] += tauValue * singleLookUp[s * NUMBINS + intensity];
3295 maxPrIndex = uniqueFlowgrams[centroids[i] * numFlowCells + index];
3296 maxPrValue = pr[maxPrIndex];
3298 if(count > MIN_COUNT){
3300 double norm = 0.0000;
3302 for(int s=0;s<HOMOPS;s++){
3303 norm += exp(-(pr[s] - maxPrValue));
3306 for(int s=1;s<=maxPrIndex;s++){
3308 double temp = 0.0000;
3310 U += exp(-(pr[s-1]-maxPrValue))/norm;
3318 temp = floor(-10 * temp);
3319 value = (int)floor(temp);
3320 if(value > 100){ value = 100; }
3322 qualities[i][base] = (int)value;
3332 if(otuCounts[i] > 0){
3333 qualityFile << '>' << seqNameVector[mapUniqueToSeq[i]] << endl;
3335 int j=4; //need to get past the first four bases
3336 while(qualities[i][j] != -1){
3337 qualityFile << qualities[i][j] << ' ';
3338 if (j > qualities[i].size()) { break; }
3341 qualityFile << endl;
3344 qualityFile.close();
3345 outputNames.push_back(qualityFileName); outputTypes["qfile"].push_back(qualityFileName);
3348 catch(exception& e) {
3349 m->errorOut(e, "ShhherCommand", "writeQualities");
3354 /**************************************************************************************************/
3356 void ShhherCommand::writeSequences(string thisCompositeFASTAFileName, int numOTUs, int numFlowCells, string fastaFileName, vector<int> otuCounts, vector<short>& uniqueFlowgrams, vector<string>& seqNameVector, vector<vector<int> >& aaI, vector<int>& centroids){
3360 m->openOutputFile(fastaFileName, fastaFile);
3362 vector<string> names(numOTUs, "");
3364 for(int i=0;i<numOTUs;i++){
3366 if (m->control_pressed) { break; }
3368 int index = centroids[i];
3370 if(otuCounts[i] > 0){
3371 fastaFile << '>' << seqNameVector[aaI[i][0]] << endl;
3375 for(int j=0;j<numFlowCells;j++){
3377 char base = flowOrder[j % flowOrder.length()];
3378 for(int k=0;k<uniqueFlowgrams[index * numFlowCells + j];k++){
3383 if (newSeq.length() >= 4) { fastaFile << newSeq.substr(4) << endl; }
3384 else { fastaFile << "NNNN" << endl; }
3389 outputNames.push_back(fastaFileName); outputTypes["fasta"].push_back(fastaFileName);
3391 if(thisCompositeFASTAFileName != ""){
3392 m->appendFiles(fastaFileName, thisCompositeFASTAFileName);
3395 catch(exception& e) {
3396 m->errorOut(e, "ShhherCommand", "writeSequences");
3401 /**************************************************************************************************/
3403 void ShhherCommand::writeNames(string thisCompositeNamesFileName, int numOTUs, string nameFileName, vector<int> otuCounts, vector<string>& seqNameVector, vector<vector<int> >& aaI, vector<int>& nSeqsPerOTU){
3407 m->openOutputFile(nameFileName, nameFile);
3409 for(int i=0;i<numOTUs;i++){
3411 if (m->control_pressed) { break; }
3413 if(otuCounts[i] > 0){
3414 nameFile << seqNameVector[aaI[i][0]] << '\t' << seqNameVector[aaI[i][0]];
3416 for(int j=1;j<nSeqsPerOTU[i];j++){
3417 nameFile << ',' << seqNameVector[aaI[i][j]];
3424 outputNames.push_back(nameFileName); outputTypes["name"].push_back(nameFileName);
3427 if(thisCompositeNamesFileName != ""){
3428 m->appendFiles(nameFileName, thisCompositeNamesFileName);
3431 catch(exception& e) {
3432 m->errorOut(e, "ShhherCommand", "writeNames");
3437 /**************************************************************************************************/
3439 void ShhherCommand::writeGroups(string groupFileName, string fileRoot, int numSeqs, vector<string>& seqNameVector){
3442 m->openOutputFile(groupFileName, groupFile);
3444 for(int i=0;i<numSeqs;i++){
3445 if (m->control_pressed) { break; }
3446 groupFile << seqNameVector[i] << '\t' << fileRoot << endl;
3449 outputNames.push_back(groupFileName); outputTypes["group"].push_back(groupFileName);
3452 catch(exception& e) {
3453 m->errorOut(e, "ShhherCommand", "writeGroups");
3458 /**************************************************************************************************/
3460 void ShhherCommand::writeClusters(string otuCountsFileName, int numOTUs, int numFlowCells, vector<int> otuCounts, vector<int>& centroids, vector<short>& uniqueFlowgrams, vector<string>& seqNameVector, vector<vector<int> >& aaI, vector<int>& nSeqsPerOTU, vector<int>& lengths, vector<short>& flowDataIntI){
3462 ofstream otuCountsFile;
3463 m->openOutputFile(otuCountsFileName, otuCountsFile);
3465 string bases = flowOrder;
3467 for(int i=0;i<numOTUs;i++){
3469 if (m->control_pressed) {
3472 //output the translated version of the centroid sequence for the otu
3473 if(otuCounts[i] > 0){
3474 int index = centroids[i];
3476 otuCountsFile << "ideal\t";
3477 for(int j=8;j<numFlowCells;j++){
3478 char base = bases[j % bases.length()];
3479 for(int s=0;s<uniqueFlowgrams[index * numFlowCells + j];s++){
3480 otuCountsFile << base;
3483 otuCountsFile << endl;
3485 for(int j=0;j<nSeqsPerOTU[i];j++){
3486 int sequence = aaI[i][j];
3487 otuCountsFile << seqNameVector[sequence] << '\t';
3491 for(int k=0;k<lengths[sequence];k++){
3492 char base = bases[k % bases.length()];
3493 int freq = int(0.01 * (double)flowDataIntI[sequence * numFlowCells + k] + 0.5);
3495 for(int s=0;s<freq;s++){
3497 //otuCountsFile << base;
3501 if (newSeq.length() >= 4) { otuCountsFile << newSeq.substr(4) << endl; }
3502 else { otuCountsFile << "NNNN" << endl; }
3504 otuCountsFile << endl;
3507 otuCountsFile.close();
3508 outputNames.push_back(otuCountsFileName); outputTypes["counts"].push_back(otuCountsFileName);
3511 catch(exception& e) {
3512 m->errorOut(e, "ShhherCommand", "writeClusters");
3517 /**************************************************************************************************/
3519 void ShhherCommand::getSingleLookUp(){
3521 // these are the -log probabilities that a signal corresponds to a particular homopolymer length
3522 singleLookUp.assign(HOMOPS * NUMBINS, 0);
3525 ifstream lookUpFile;
3526 m->openInputFile(lookupFileName, lookUpFile);
3528 for(int i=0;i<HOMOPS;i++){
3530 if (m->control_pressed) { break; }
3533 lookUpFile >> logFracFreq;
3535 for(int j=0;j<NUMBINS;j++) {
3536 lookUpFile >> singleLookUp[index];
3542 catch(exception& e) {
3543 m->errorOut(e, "ShhherCommand", "getSingleLookUp");
3548 /**************************************************************************************************/
3550 void ShhherCommand::getJointLookUp(){
3553 // the most likely joint probability (-log) that two intenities have the same polymer length
3554 jointLookUp.resize(NUMBINS * NUMBINS, 0);
3556 for(int i=0;i<NUMBINS;i++){
3558 if (m->control_pressed) { break; }
3560 for(int j=0;j<NUMBINS;j++){
3562 double minSum = 100000000;
3564 for(int k=0;k<HOMOPS;k++){
3565 double sum = singleLookUp[k * NUMBINS + i] + singleLookUp[k * NUMBINS + j];
3567 if(sum < minSum) { minSum = sum; }
3569 jointLookUp[i * NUMBINS + j] = minSum;
3573 catch(exception& e) {
3574 m->errorOut(e, "ShhherCommand", "getJointLookUp");
3579 /**************************************************************************************************/
3581 double ShhherCommand::getProbIntensity(int intIntensity){
3584 double minNegLogProb = 100000000;
3587 for(int i=0;i<HOMOPS;i++){//loop signal strength
3589 if (m->control_pressed) { break; }
3591 float negLogProb = singleLookUp[i * NUMBINS + intIntensity];
3592 if(negLogProb < minNegLogProb) { minNegLogProb = negLogProb; }
3595 return minNegLogProb;
3597 catch(exception& e) {
3598 m->errorOut(e, "ShhherCommand", "getProbIntensity");