2 // sffmultiplecommand.cpp
5 // Created by Sarah Westcott on 8/14/12.
6 // Copyright (c) 2012 Schloss Lab. All rights reserved.
9 #include "sffmultiplecommand.h"
13 //**********************************************************************************************************************
14 vector<string> SffMultipleCommand::setParameters(){
16 CommandParameter pfile("file", "InputTypes", "", "", "none", "none", "none","fasta-name",false,true,true); parameters.push_back(pfile);
19 CommandParameter ptrim("trim", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(ptrim);
22 CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop);
23 CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows);
24 CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows);
25 CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(ppdiffs);
26 CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(pbdiffs);
27 CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pldiffs);
28 CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(psdiffs);
29 CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(ptdiffs);
30 CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal);
31 CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise);
32 CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder);
34 CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup);
35 CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff);
36 CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter);
37 CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge);
38 CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma);
39 CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta);
41 //trim.seqs parameters
42 CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles);
43 CommandParameter pflip("flip", "Boolean", "", "F", "", "", "","",false,false,true); parameters.push_back(pflip);
44 CommandParameter pmaxambig("maxambig", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(pmaxambig);
45 CommandParameter pminlength("minlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pminlength);
46 CommandParameter pmaxlength("maxlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pmaxlength);
47 CommandParameter pkeepforward("keepforward", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pkeepforward);
48 CommandParameter pkeepfirst("keepfirst", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pkeepfirst);
49 CommandParameter premovelast("removelast", "Number", "", "0", "", "", "","",false,false); parameters.push_back(premovelast);
52 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
53 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
54 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
56 vector<string> myArray;
57 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
61 m->errorOut(e, "SffMultipleCommand", "setParameters");
65 //**********************************************************************************************************************
66 string SffMultipleCommand::getHelpString(){
68 string helpString = "";
69 helpString += "The sff.multiple command reads a file containing sff filenames and optional oligos filenames. It runs the files through sffinfo, trim.flows, shhh.flows and trim.seqs combining the results.\n";
70 helpString += "The sff.multiple command parameters are: ";
71 vector<string> parameters = setParameters();
72 for (int i = 0; i < parameters.size()-1; i++) {
73 helpString += parameters[i] + ", ";
75 helpString += parameters[parameters.size()-1] + ".\n";
76 helpString += "The file parameter allows you to enter the a file containing the list of sff files and optional oligos files.\n";
77 helpString += "The trim parameter allows you to indicate if you would like a sequences and quality scores generated by sffinfo trimmed to the clipQualLeft and clipQualRight values. Default=True. \n";
78 helpString += "The maxambig parameter allows you to set the maximum number of ambigious bases allowed. The default is -1.\n";
79 helpString += "The maxhomop parameter allows you to set a maximum homopolymer length. \n";
80 helpString += "The minlength parameter allows you to set and minimum sequence length. \n";
81 helpString += "The maxlength parameter allows you to set and maximum sequence length. \n";
82 helpString += "The tdiffs parameter is used to specify the total number of differences allowed in the sequence. The default is pdiffs + bdiffs + sdiffs + ldiffs.\n";
83 helpString += "The bdiffs parameter is used to specify the number of differences allowed in the barcode. The default is 0.\n";
84 helpString += "The pdiffs parameter is used to specify the number of differences allowed in the primer. The default is 0.\n";
85 helpString += "The ldiffs parameter is used to specify the number of differences allowed in the linker. The default is 0.\n";
86 helpString += "The sdiffs parameter is used to specify the number of differences allowed in the spacer. The default is 0.\n";
87 helpString += "The allfiles parameter will create separate group and fasta file for each grouping. The default is F.\n";
88 helpString += "The keepforward parameter allows you to indicate whether you want the forward primer removed or not. The default is F, meaning remove the forward primer.\n";
89 helpString += "The keepfirst parameter trims the sequence to the first keepfirst number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements. \n";
90 helpString += "The removelast removes the last removelast number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements.\n";
91 helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n";
92 helpString += "Example sff.multiple(file=mySffOligosFile.txt, trim=F).\n";
93 helpString += "Note: No spaces between parameter labels (i.e. file), '=' and parameters (i.e.mySffOligosFile.txt).\n";
97 m->errorOut(e, "SffMultipleCommand", "getHelpString");
101 //**********************************************************************************************************************
102 string SffMultipleCommand::getOutputPattern(string type) {
106 if (type == "fasta") { pattern = "[filename],fasta"; }
107 else if (type == "name") { pattern = "[filename],names"; }
108 else if (type == "group") { pattern = "[filename],groups"; }
109 else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
113 catch(exception& e) {
114 m->errorOut(e, "SffMultipleCommand", "getOutputPattern");
118 //**********************************************************************************************************************
119 SffMultipleCommand::SffMultipleCommand(){
121 abort = true; calledHelp = true;
123 vector<string> tempOutNames;
124 outputTypes["fasta"] = tempOutNames;
125 outputTypes["name"] = tempOutNames;
126 outputTypes["group"] = tempOutNames;
128 catch(exception& e) {
129 m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
133 //**********************************************************************************************************************
135 SffMultipleCommand::SffMultipleCommand(string option) {
137 abort = false; calledHelp = false; append=false; makeGroup=false;
139 //allow user to run help
140 if(option == "help") { help(); abort = true; calledHelp = true; }
141 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
144 //valid paramters for this command
145 vector<string> myArray = setParameters();
147 OptionParser parser(option);
148 map<string, string> parameters = parser.getParameters();
150 ValidParameters validParameter;
151 map<string,string>::iterator it;
153 //check to make sure all parameters are valid for command
154 for (it = parameters.begin(); it != parameters.end(); it++) {
155 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
158 //initialize outputTypes
159 vector<string> tempOutNames;
160 outputTypes["fasta"] = tempOutNames;
161 outputTypes["name"] = tempOutNames;
162 outputTypes["group"] = tempOutNames;
165 //if the user changes the output directory command factory will send this info to us in the output parameter
166 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
168 //if the user changes the input directory command factory will send this info to us in the output parameter
169 inputDir = validParameter.validFile(parameters, "inputdir", false);
170 if (inputDir == "not found"){ inputDir = ""; }
173 it = parameters.find("file");
174 //user has given a template file
175 if(it != parameters.end()){
176 path = m->hasPath(it->second);
177 //if the user has not given a path then, add inputdir. else leave path alone.
178 if (path == "") { parameters["file"] = inputDir + it->second; }
181 it = parameters.find("lookup");
182 //user has given a template file
183 if(it != parameters.end()){
184 path = m->hasPath(it->second);
185 //if the user has not given a path then, add inputdir. else leave path alone.
186 if (path == "") { parameters["lookup"] = inputDir + it->second; }
190 filename = validParameter.validFile(parameters, "file", true);
191 if (filename == "not open") { filename = ""; abort = true; }
192 else if (filename == "not found") { filename = ""; }
195 temp = validParameter.validFile(parameters, "trim", false); if (temp == "not found"){ temp = "T"; }
196 trim = m->isTrue(temp);
198 temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; }
199 m->mothurConvert(temp, minFlows);
201 temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; }
202 m->mothurConvert(temp, maxFlows);
204 temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; }
205 m->mothurConvert(temp, maxHomoP);
207 temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; }
208 m->mothurConvert(temp, signal);
210 temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; }
211 m->mothurConvert(temp, noise);
213 temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; }
214 m->mothurConvert(temp, bdiffs);
216 temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; }
217 m->mothurConvert(temp, pdiffs);
219 temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; }
220 m->mothurConvert(temp, ldiffs);
222 temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; }
223 m->mothurConvert(temp, sdiffs);
225 temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); }
226 m->mothurConvert(temp, tdiffs);
228 if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; }
231 temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
232 m->setProcessors(temp);
233 m->mothurConvert(temp, processors);
235 temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
236 if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
239 if (toupper(temp[0]) == 'A') { flowOrder = "A"; }
240 else if(toupper(temp[0]) == 'B'){
242 else if(toupper(temp[0]) == 'I'){
245 m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
250 temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; }
251 m->mothurConvert(temp, cutoff);
253 temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; }
256 temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; }
257 m->mothurConvert(temp, maxIters);
259 temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; }
260 m->mothurConvert(temp, largeSize);
261 if (largeSize != 0) { large = true; }
262 else { large = false; }
263 if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); }
265 temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; }
266 m->mothurConvert(temp, sigma);
268 temp = validParameter.validFile(parameters, "flip", false);
269 if (temp == "not found") { flip = 0; }
270 else { flip = m->isTrue(temp); }
272 temp = validParameter.validFile(parameters, "maxambig", false); if (temp == "not found") { temp = "-1"; }
273 m->mothurConvert(temp, maxAmbig);
275 temp = validParameter.validFile(parameters, "minlength", false); if (temp == "not found") { temp = "0"; }
276 m->mothurConvert(temp, minLength);
278 temp = validParameter.validFile(parameters, "maxlength", false); if (temp == "not found") { temp = "0"; }
279 m->mothurConvert(temp, maxLength);
281 temp = validParameter.validFile(parameters, "keepfirst", false); if (temp == "not found") { temp = "0"; }
282 convert(temp, keepFirst);
284 temp = validParameter.validFile(parameters, "removelast", false); if (temp == "not found") { temp = "0"; }
285 convert(temp, removeLast);
287 temp = validParameter.validFile(parameters, "allfiles", false); if (temp == "not found") { temp = "F"; }
288 allFiles = m->isTrue(temp);
290 temp = validParameter.validFile(parameters, "keepforward", false); if (temp == "not found") { temp = "F"; }
291 keepforward = m->isTrue(temp);
293 temp = validParameter.validFile(parameters, "lookup", true);
294 if (temp == "not found") {
295 string path = m->argv;
296 string tempPath = path;
297 for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
298 path = path.substr(0, (tempPath.find_last_of('m')));
300 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
301 path += "lookupFiles/";
303 path += "lookupFiles\\";
305 lookupFileName = m->getFullPathName(path) + "LookUp_Titanium.pat";
306 bool ableToOpen = m->checkLocations(lookupFileName, inputDir);
307 if (!ableToOpen) { abort=true; }
308 }else if(temp == "not open") {
310 lookupFileName = validParameter.validFile(parameters, "lookup", false);
312 //if you can't open it its not inputDir, try mothur excutable location
313 string exepath = m->argv;
314 string tempPath = exepath;
315 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
316 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
318 string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName);
319 m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
321 int ableToOpen = m->openInputFile(tryPath, in2, "noerror");
323 lookupFileName = tryPath;
325 if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
326 }else { lookupFileName = temp; }
329 catch(exception& e) {
330 m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
334 //**********************************************************************************************************************
335 int SffMultipleCommand::execute(){
337 if (abort == true) { if (calledHelp) { return 0; } return 2; }
339 vector<string> sffFiles, oligosFiles;
340 readFile(sffFiles, oligosFiles);
342 string thisOutputDir = outputDir;
343 if (thisOutputDir == "") { thisOutputDir = m->hasPath(filename); }
344 string fileroot = thisOutputDir + m->getRootName(m->getSimpleName(filename));
345 map<string, string> variables;
346 variables["[filename]"] = fileroot;
347 string fasta = getOutputFileName("fasta",variables);
348 string name = getOutputFileName("name",variables);
349 string group = getOutputFileName("group",variables);
351 if (m->control_pressed) { return 0; }
353 if (sffFiles.size() < processors) { processors = sffFiles.size(); }
355 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
357 //trim.flows, shhh.flows cannot handle multiple processors for windows.
358 processors = 1; m->mothurOut("This command can only use 1 processor on Windows platforms, using 1 processors.\n\n");
360 if (processors == 1) { driver(sffFiles, oligosFiles, 0, sffFiles.size(), fasta, name, group); }
361 else { createProcesses(sffFiles, oligosFiles, fasta, name, group); }
363 if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; }
366 outputNames.push_back(fasta); outputTypes["fasta"].push_back(fasta);
367 m->setFastaFile(fasta);
368 outputNames.push_back(name); outputTypes["name"].push_back(name);
369 m->setNameFile(name);
370 if (makeGroup) { outputNames.push_back(group); outputTypes["group"].push_back(group); m->setGroupFile(group); }
373 m->setProcessors(toString(processors));
375 //report output filenames
376 m->mothurOutEndLine();
377 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
378 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
379 m->mothurOutEndLine();
383 catch(exception& e) {
384 m->errorOut(e, "SffMultipleCommand", "execute");
388 //**********************************************************************************************************************
389 int SffMultipleCommand::readFile(vector<string>& sffFiles, vector<string>& oligosFiles){
393 m->openInputFile(filename, in);
394 bool allBlank = true;
400 if (m->control_pressed) { break; }
404 //ignore file pairing
405 if(sff[0] == '#'){ while (!in.eof()) { char c = in.get(); if (c == 10 || c == 13){ break; } } m->gobble(in); }
406 else { //check for oligos file
407 bool ableToOpenSff = m->checkLocations(sff, inputDir);
411 // get rest of line in case there is a oligos filename
414 if (c == 10 || c == 13 || c == -1){ break; }
415 else if (c == 32 || c == 9){;} //space or tab
416 else { oligos += c; }
420 sffFiles.push_back(sff);
422 bool ableToOpenOligos = m->checkLocations(oligos, inputDir);
423 if (ableToOpenOligos) { allBlank = false; }
424 else { m->mothurOut("Can not find " + oligos + ". Ignoring.\n"); oligos = ""; }
426 if (oligos == "") { allFull = false; }
427 oligosFiles.push_back(oligos); //will push a blank if there is not an oligos for this sff file
428 }else { m->mothurOut("Can not find " + sff + ". Ignoring.\n"); }
434 if (allBlank || allFull) { append = true; }
435 if (allFull) { makeGroup = true; }
439 catch(exception& e) {
440 m->errorOut(e, "SffMultipleCommand", "readFile");
444 //**********************************************************************************************************************
445 //runs sffinfo, summary.seqs, trim.flows, shhh.flows, trim.seqs, summary.seqs for each sff file.
446 int SffMultipleCommand::driver(vector<string> sffFiles, vector<string> oligosFiles, int start, int end, string fasta, string name, string group){
448 m->mothurRemove(fasta); m->mothurRemove(name); m->mothurRemove(group);
450 for (int s = start; s < end; s++) {
452 string sff = sffFiles[s];
453 string oligos = oligosFiles[s];
455 m->mothurOut("\n>>>>>\tProcessing " + sff + " (file " + toString(s+1) + " of " + toString(sffFiles.size()) + ")\t<<<<<\n");
458 string redirects = "";
459 if (inputDir != "") { redirects += ", inputdir=" + inputDir; }
460 if (outputDir != "") { redirects += ", outputdir=" + outputDir; }
461 string inputString = "sff=" + sff + ", flow=T";
462 if (trim) { inputString += ", trim=T"; }
463 if (redirects != "") { inputString += redirects; }
464 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
465 m->mothurOut("Running command: sffinfo(" + inputString + ")"); m->mothurOutEndLine();
466 m->mothurCalling = true;
468 Command* sffCommand = new SffInfoCommand(inputString);
469 sffCommand->execute();
471 if (m->control_pressed){ break; }
473 map<string, vector<string> > filenames = sffCommand->getOutputFiles();
476 m->mothurCalling = false;
477 m->mothurOutEndLine();
480 if (outputDir != "") { redirects += ", outputdir=" + outputDir; }
482 //run summary.seqs on the fasta file
483 string fastaFile = "";
484 map<string, vector<string> >::iterator it = filenames.find("fasta");
485 if (it != filenames.end()) { if ((it->second).size() != 0) { fastaFile = (it->second)[0]; } }
486 else { m->mothurOut("[ERROR]: sffinfo did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
488 inputString = "fasta=" + fastaFile + ", processors=1";
489 if (redirects != "") { inputString += redirects; }
490 m->mothurOutEndLine();
491 m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine();
492 m->mothurCalling = true;
494 Command* summarySeqsCommand = new SeqSummaryCommand(inputString);
495 summarySeqsCommand->execute();
497 if (m->control_pressed){ break; }
499 map<string, vector<string> > temp = summarySeqsCommand->getOutputFiles();
500 mergeOutputFileList(filenames, temp);
502 delete summarySeqsCommand;
503 m->mothurCalling = false;
505 m->mothurOutEndLine();
507 //run trim.flows on the fasta file
508 string flowFile = "";
509 it = filenames.find("flow");
510 if (it != filenames.end()) { if ((it->second).size() != 0) { flowFile = (it->second)[0]; } }
511 else { m->mothurOut("[ERROR]: sffinfo did not create a flow file, quitting.\n"); m->control_pressed = true; break; }
513 inputString = "flow=" + flowFile;
514 if (oligos != "") { inputString += ", oligos=" + oligos; }
515 inputString += ", maxhomop=" + toString(maxHomoP) + ", maxflows=" + toString(maxFlows) + ", minflows=" + toString(minFlows);
516 inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs);
517 inputString += ", tdiffs=" + toString(tdiffs) + ", signal=" + toString(signal) + ", noise=" + toString(noise) + ", order=" + flowOrder + ", processors=1";
518 if (redirects != "") { inputString += redirects; }
519 m->mothurOutEndLine();
520 m->mothurOut("Running command: trim.flows(" + inputString + ")"); m->mothurOutEndLine();
521 m->mothurCalling = true;
523 Command* trimFlowCommand = new TrimFlowsCommand(inputString);
524 trimFlowCommand->execute();
526 if (m->control_pressed){ break; }
528 temp = trimFlowCommand->getOutputFiles();
529 mergeOutputFileList(filenames, temp);
531 delete trimFlowCommand;
532 m->mothurCalling = false;
535 string fileFileName = "";
538 it = temp.find("file");
539 if (it != temp.end()) { if ((it->second).size() != 0) { fileFileName = (it->second)[0]; } }
540 else { m->mothurOut("[ERROR]: trim.flows did not create a file file, quitting.\n"); m->control_pressed = true; break; }
542 vector<string> flowFiles;
543 it = temp.find("flow");
544 if (it != temp.end()) { if ((it->second).size() != 0) { flowFiles = (it->second); } }
545 else { m->mothurOut("[ERROR]: trim.flows did not create a flow file, quitting.\n"); m->control_pressed = true; break; }
547 for (int i = 0; i < flowFiles.size(); i++) {
548 string end = flowFiles[i].substr(flowFiles[i].length()-9);
549 if (end == "trim.flow") {
550 flowFile = flowFiles[i]; i+=flowFiles.size(); //if we found the trim.flow file stop looking
555 if ((fileFileName == "") && (flowFile == "")) { m->mothurOut("[ERROR]: trim.flows did not create a file file or a trim.flow file, quitting.\n"); m->control_pressed = true; break; }
557 if (fileFileName != "") { inputString = "file=" + fileFileName; }
558 else { inputString = "flow=" + flowFile; }
560 inputString += ", lookup=" + lookupFileName + ", cutoff=" + toString(cutoff); + ", maxiters=" + toString(maxIters);
561 if (large) { inputString += ", large=" + toString(largeSize); }
562 inputString += ", sigma=" +toString(sigma);
563 inputString += ", mindelta=" + toString(minDelta);
564 inputString += ", order=" + flowOrder + ", processors=1";
565 if (redirects != "") { inputString += redirects; }
567 m->mothurOutEndLine();
568 m->mothurOut("Running command: shhh.flows(" + inputString + ")"); m->mothurOutEndLine();
569 m->mothurCalling = true;
571 Command* shhhFlowCommand = new ShhherCommand(inputString);
572 shhhFlowCommand->execute();
574 if (m->control_pressed){ break; }
576 temp = shhhFlowCommand->getOutputFiles();
577 mergeOutputFileList(filenames, temp);
579 delete shhhFlowCommand;
580 m->mothurCalling = false;
582 vector<string> fastaFiles;
583 vector<string> nameFiles;
584 it = temp.find("fasta");
585 if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
586 else { m->mothurOut("[ERROR]: shhh.flows did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
588 it = temp.find("name");
589 if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
590 else { m->mothurOut("[ERROR]: shhh.flows did not create a name file, quitting.\n"); m->control_pressed = true; break; }
592 //find fasta and name files with the shortest name. This is because if there is a composite name it will be the shortest.
593 fastaFile = fastaFiles[0];
594 for (int i = 1; i < fastaFiles.size(); i++) { if (fastaFiles[i].length() < fastaFile.length()) { fastaFile = fastaFiles[i]; } }
595 string nameFile = nameFiles[0];
596 for (int i = 1; i < nameFiles.size(); i++) { if (nameFiles[i].length() < nameFile.length()) { nameFile = nameFiles[i]; } }
598 inputString = "fasta=" + fastaFile + ", name=" + nameFile;
599 if (oligos != "") { inputString += ", oligos=" + oligos; }
600 if (allFiles) { inputString += ", allfiles=t"; }
601 else { inputString += ", allfiles=f"; }
602 if (flip) { inputString += ", flip=t"; }
603 else { inputString += ", flip=f"; }
604 if (keepforward) { inputString += ", keepforward=t"; }
605 else { inputString += ", keepforward=f"; }
608 inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs);
609 inputString += ", tdiffs=" + toString(tdiffs) + ", maxambig=" + toString(maxAmbig) + ", minlength=" + toString(minLength) + ", maxlength=" + toString(maxLength);
610 if (keepFirst != 0) { inputString += ", keepfirst=" + toString(keepFirst); }
611 if (removeLast != 0) { inputString += ", removelast=" + toString(removeLast); }
612 inputString += ", processors=1";
613 if (redirects != "") { inputString += redirects; }
615 m->mothurOutEndLine();
616 m->mothurOut("Running command: trim.seqs(" + inputString + ")"); m->mothurOutEndLine();
617 m->mothurCalling = true;
619 Command* trimseqsCommand = new TrimSeqsCommand(inputString);
620 trimseqsCommand->execute();
622 if (m->control_pressed){ break; }
624 temp = trimseqsCommand->getOutputFiles();
625 mergeOutputFileList(filenames, temp);
627 delete trimseqsCommand;
628 m->mothurCalling = false;
630 it = temp.find("fasta");
631 if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
632 else { m->mothurOut("[ERROR]: trim.seqs did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
634 for (int i = 0; i < fastaFiles.size(); i++) {
635 string end = fastaFiles[i].substr(fastaFiles[i].length()-10);
636 if (end == "trim.fasta") {
637 fastaFile = fastaFiles[i]; i+=fastaFiles.size(); //if we found the trim.fasta file stop looking
641 it = temp.find("name");
642 if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
643 else { m->mothurOut("[ERROR]: trim.seqs did not create a name file, quitting.\n"); m->control_pressed = true; break; }
645 for (int i = 0; i < nameFiles.size(); i++) {
646 string end = nameFiles[i].substr(nameFiles[i].length()-10);
647 if (end == "trim.names") {
648 nameFile = nameFiles[i]; i+=nameFiles.size(); //if we found the trim.names file stop looking
652 vector<string> groupFiles;
653 string groupFile = "";
655 it = temp.find("group");
656 if (it != temp.end()) { if ((it->second).size() != 0) { groupFiles = (it->second); } }
658 //find group file with the shortest name. This is because if there is a composite group file it will be the shortest.
659 groupFile = groupFiles[0];
660 for (int i = 1; i < groupFiles.size(); i++) { if (groupFiles[i].length() < groupFile.length()) { groupFile = groupFiles[i]; } }
663 inputString = "fasta=" + fastaFile + ", processors=1, name=" + nameFile;
664 if (redirects != "") { inputString += redirects; }
665 m->mothurOutEndLine();
666 m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine();
667 m->mothurCalling = true;
669 summarySeqsCommand = new SeqSummaryCommand(inputString);
670 summarySeqsCommand->execute();
672 if (m->control_pressed){ break; }
674 temp = summarySeqsCommand->getOutputFiles();
675 mergeOutputFileList(filenames, temp);
677 delete summarySeqsCommand;
678 m->mothurCalling = false;
680 m->mothurOutEndLine();
681 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
684 m->appendFiles(fastaFile, fasta);
685 m->appendFiles(nameFile, name);
686 if (makeGroup) { m->appendFiles(groupFile, group); }
690 for (it = filenames.begin(); it != filenames.end(); it++) {
691 for (int i = 0; i < (it->second).size(); i++) {
692 outputNames.push_back((it->second)[i]); outputTypes[it->first].push_back((it->second)[i]);
700 catch(exception& e) {
701 m->errorOut(e, "SffMultipleCommand", "driver");
705 //**********************************************************************************************************************
706 int SffMultipleCommand::mergeOutputFileList(map<string, vector<string> >& files, map<string, vector<string> >& temp){
708 map<string, vector<string> >::iterator it;
709 for (it = temp.begin(); it != temp.end(); it++) {
710 map<string, vector<string> >::iterator it2 = files.find(it->first);
711 if (it2 == files.end()) { //we do not already have this type so just add it
712 files[it->first] = it->second;
714 for (int i = 0; i < (it->second).size(); i++) {
715 files[it->first].push_back((it->second)[i]);
722 catch(exception& e) {
723 m->errorOut(e, "SffMultipleCommand", "mergeOutputFileList");
727 //**********************************************************************************************************************
728 int SffMultipleCommand::createProcesses(vector<string> sffFiles, vector<string> oligosFiles, string fasta, string name, string group){
730 vector<int> processIDS;
734 //divide the groups between the processors
735 vector<linePair> lines;
736 vector<int> numFilesToComplete;
737 int numFilesPerProcessor = sffFiles.size() / processors;
738 for (int i = 0; i < processors; i++) {
739 int startIndex = i * numFilesPerProcessor;
740 int endIndex = (i+1) * numFilesPerProcessor;
741 if(i == (processors - 1)){ endIndex = sffFiles.size(); }
742 lines.push_back(linePair(startIndex, endIndex));
743 numFilesToComplete.push_back((endIndex-startIndex));
746 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
748 //loop through and create all the processes you want
749 while (process != processors) {
753 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
756 num = driver(sffFiles, oligosFiles, lines[process].start, lines[process].end, fasta + m->mothurGetpid(process) + ".temp", name + m->mothurGetpid(process) + ".temp", group + m->mothurGetpid(process) + ".temp");
758 //pass numSeqs to parent
760 string tempFile = m->mothurGetpid(process) + ".num.temp";
761 m->openOutputFile(tempFile, out);
762 out << num << '\t' << outputNames.size() << endl;
763 for (int i = 0; i < outputNames.size(); i++) { out << outputNames[i] << endl; }
768 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
769 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
775 num = driver(sffFiles, oligosFiles, lines[0].start, lines[0].end, fasta, name, group);
777 //force parent to wait until all the processes are done
778 for (int i=0;i<processIDS.size();i++) {
779 int temp = processIDS[i];
783 for (int i=0;i<processIDS.size();i++) {
785 string tempFile = toString(processIDS[i]) + ".num.temp";
786 m->openInputFile(tempFile, in);
788 int tempNum = 0; int outputNamesSize = 0;
789 in >> tempNum >> outputNamesSize; m->gobble(in);
790 for (int j = 0; j < outputNamesSize; j++) {
792 in >> tempName; m->gobble(in);
793 outputNames.push_back(tempName);
795 if (tempNum != numFilesToComplete[i+1]) {
796 m->mothurOut("[ERROR]: main process expected " + toString(processIDS[i]) + " to complete " + toString(numFilesToComplete[i+1]) + " files, and it only reported completing " + toString(tempNum) + ". This will cause file mismatches. The flow files may be too large to process with multiple processors. \n");
799 in.close(); m->mothurRemove(tempFile);
802 m->appendFiles(fasta+toString(processIDS[i])+".temp", fasta); m->mothurRemove(fasta+toString(processIDS[i])+".temp");
803 m->appendFiles(name+toString(processIDS[i])+".temp", name); m->mothurRemove(name+toString(processIDS[i])+".temp");
804 if (makeGroup) { m->appendFiles(group+toString(processIDS[i])+".temp", group); m->mothurRemove(group+toString(processIDS[i])+".temp"); }
811 catch(exception& e) {
812 m->errorOut(e, "ShhherCommand", "createProcesses");
816 //**********************************************************************************************************************