2 * chimerauchimecommand.cpp
5 * Created by westcott on 5/13/11.
6 * Copyright 2011 Schloss Lab. All rights reserved.
10 #include "chimerauchimecommand.h"
11 #include "deconvolutecommand.h"
13 #include "sequence.hpp"
14 #include "referencedb.h"
17 //**********************************************************************************************************************
18 vector<string> ChimeraUchimeCommand::setParameters(){
20 CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
21 CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
22 CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
23 CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup);
24 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
25 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
26 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
27 CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "",false,false); parameters.push_back(pabskew);
28 CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pchimealns);
29 CommandParameter pminh("minh", "Number", "", "0.3", "", "", "",false,false); parameters.push_back(pminh);
30 CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pmindiv);
31 CommandParameter pxn("xn", "Number", "", "8.0", "", "", "",false,false); parameters.push_back(pxn);
32 CommandParameter pdn("dn", "Number", "", "1.4", "", "", "",false,false); parameters.push_back(pdn);
33 CommandParameter pxa("xa", "Number", "", "1", "", "", "",false,false); parameters.push_back(pxa);
34 CommandParameter pchunks("chunks", "Number", "", "4", "", "", "",false,false); parameters.push_back(pchunks);
35 CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "",false,false); parameters.push_back(pminchunk);
36 CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "",false,false); parameters.push_back(pidsmoothwindow);
37 //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
38 CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "",false,false); parameters.push_back(pmaxp);
39 CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps);
40 CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps2);
41 CommandParameter pminlen("minlen", "Number", "", "10", "", "", "",false,false); parameters.push_back(pminlen);
42 CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "",false,false); parameters.push_back(pmaxlen);
43 CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pucl);
44 CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pqueryfract);
46 vector<string> myArray;
47 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
51 m->errorOut(e, "ChimeraUchimeCommand", "setParameters");
55 //**********************************************************************************************************************
56 string ChimeraUchimeCommand::getHelpString(){
58 string helpString = "";
59 helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
60 helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
61 helpString += "The chimera.uchime command parameters are fasta, name, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
62 helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
63 helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
64 helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
65 helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
66 helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
67 helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
68 helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
69 helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n";
70 helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n";
71 helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n";
72 helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n";
73 helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n";
74 helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n";
75 helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
76 helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
77 helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
78 //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
79 helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
80 helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
81 helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
82 helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n";
83 helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n";
84 helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n";
85 helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n";
87 helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n";
89 helpString += "The chimera.uchime command should be in the following format: \n";
90 helpString += "chimera.uchime(fasta=yourFastaFile, reference=yourTemplate) \n";
91 helpString += "Example: chimera.uchime(fasta=AD.align, reference=silva.gold.align) \n";
92 helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFastaFile).\n";
96 m->errorOut(e, "ChimeraUchimeCommand", "getHelpString");
100 //**********************************************************************************************************************
101 ChimeraUchimeCommand::ChimeraUchimeCommand(){
103 abort = true; calledHelp = true;
105 vector<string> tempOutNames;
106 outputTypes["chimera"] = tempOutNames;
107 outputTypes["accnos"] = tempOutNames;
108 outputTypes["alns"] = tempOutNames;
110 catch(exception& e) {
111 m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand");
115 //***************************************************************************************************************
116 ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
118 abort = false; calledHelp = false;
119 ReferenceDB* rdb = ReferenceDB::getInstance();
121 //allow user to run help
122 if(option == "help") { help(); abort = true; calledHelp = true; }
123 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
126 vector<string> myArray = setParameters();
128 OptionParser parser(option);
129 map<string,string> parameters = parser.getParameters();
131 ValidParameters validParameter("chimera.uchime");
132 map<string,string>::iterator it;
134 //check to make sure all parameters are valid for command
135 for (it = parameters.begin(); it != parameters.end(); it++) {
136 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
139 vector<string> tempOutNames;
140 outputTypes["chimera"] = tempOutNames;
141 outputTypes["accnos"] = tempOutNames;
142 outputTypes["alns"] = tempOutNames;
144 //if the user changes the input directory command factory will send this info to us in the output parameter
145 string inputDir = validParameter.validFile(parameters, "inputdir", false);
146 if (inputDir == "not found"){ inputDir = ""; }
148 //check for required parameters
149 fastafile = validParameter.validFile(parameters, "fasta", false);
150 if (fastafile == "not found") {
151 //if there is a current fasta file, use it
152 string filename = m->getFastaFile();
153 if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
154 else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
156 m->splitAtDash(fastafile, fastaFileNames);
158 //go through files and make sure they are good, if not, then disregard them
159 for (int i = 0; i < fastaFileNames.size(); i++) {
162 if (fastaFileNames[i] == "current") {
163 fastaFileNames[i] = m->getFastaFile();
164 if (fastaFileNames[i] != "") { m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine(); }
166 m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true;
167 //erase from file list
168 fastaFileNames.erase(fastaFileNames.begin()+i);
175 if (inputDir != "") {
176 string path = m->hasPath(fastaFileNames[i]);
177 //if the user has not given a path then, add inputdir. else leave path alone.
178 if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; }
184 ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror");
186 //if you can't open it, try default location
187 if (ableToOpen == 1) {
188 if (m->getDefaultPath() != "") { //default path is set
189 string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]);
190 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
192 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
194 fastaFileNames[i] = tryPath;
198 if (ableToOpen == 1) {
199 if (m->getOutputDir() != "") { //default path is set
200 string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]);
201 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
203 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
205 fastaFileNames[i] = tryPath;
211 if (ableToOpen == 1) {
212 m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
213 //erase from file list
214 fastaFileNames.erase(fastaFileNames.begin()+i);
217 m->setFastaFile(fastaFileNames[i]);
222 //make sure there is at least one valid file left
223 if (fastaFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid files."); m->mothurOutEndLine(); abort = true; }
227 //check for required parameters
229 namefile = validParameter.validFile(parameters, "name", false);
230 if (namefile == "not found") { namefile = ""; hasName = false; }
232 m->splitAtDash(namefile, nameFileNames);
234 //go through files and make sure they are good, if not, then disregard them
235 for (int i = 0; i < nameFileNames.size(); i++) {
238 if (nameFileNames[i] == "current") {
239 nameFileNames[i] = m->getNameFile();
240 if (nameFileNames[i] != "") { m->mothurOut("Using " + nameFileNames[i] + " as input file for the name parameter where you had given current."); m->mothurOutEndLine(); }
242 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
243 //erase from file list
244 nameFileNames.erase(nameFileNames.begin()+i);
251 if (inputDir != "") {
252 string path = m->hasPath(nameFileNames[i]);
253 //if the user has not given a path then, add inputdir. else leave path alone.
254 if (path == "") { nameFileNames[i] = inputDir + nameFileNames[i]; }
260 ableToOpen = m->openInputFile(nameFileNames[i], in, "noerror");
262 //if you can't open it, try default location
263 if (ableToOpen == 1) {
264 if (m->getDefaultPath() != "") { //default path is set
265 string tryPath = m->getDefaultPath() + m->getSimpleName(nameFileNames[i]);
266 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
268 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
270 nameFileNames[i] = tryPath;
274 if (ableToOpen == 1) {
275 if (m->getOutputDir() != "") { //default path is set
276 string tryPath = m->getOutputDir() + m->getSimpleName(nameFileNames[i]);
277 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
279 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
281 nameFileNames[i] = tryPath;
287 if (ableToOpen == 1) {
288 m->mothurOut("Unable to open " + nameFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
289 //erase from file list
290 nameFileNames.erase(nameFileNames.begin()+i);
293 m->setNameFile(nameFileNames[i]);
298 //make sure there is at least one valid file left
299 if (nameFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid name files."); m->mothurOutEndLine(); abort = true; }
302 if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
304 bool hasGroup = true;
305 groupfile = validParameter.validFile(parameters, "group", false);
306 if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
308 m->splitAtDash(groupfile, groupFileNames);
310 //go through files and make sure they are good, if not, then disregard them
311 for (int i = 0; i < groupFileNames.size(); i++) {
314 if (groupFileNames[i] == "current") {
315 groupFileNames[i] = m->getGroupFile();
316 if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
318 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
319 //erase from file list
320 groupFileNames.erase(groupFileNames.begin()+i);
327 if (inputDir != "") {
328 string path = m->hasPath(groupFileNames[i]);
329 //if the user has not given a path then, add inputdir. else leave path alone.
330 if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
336 ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
338 //if you can't open it, try default location
339 if (ableToOpen == 1) {
340 if (m->getDefaultPath() != "") { //default path is set
341 string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
342 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
344 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
346 groupFileNames[i] = tryPath;
350 if (ableToOpen == 1) {
351 if (m->getOutputDir() != "") { //default path is set
352 string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
353 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
355 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
357 groupFileNames[i] = tryPath;
363 if (ableToOpen == 1) {
364 m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
365 //erase from file list
366 groupFileNames.erase(groupFileNames.begin()+i);
369 m->setGroupFile(groupFileNames[i]);
374 //make sure there is at least one valid file left
375 if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
378 if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
381 //if the user changes the output directory command factory will send this info to us in the output parameter
382 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
385 it = parameters.find("reference");
386 //user has given a template file
387 if(it != parameters.end()){
388 if (it->second == "self") { templatefile = "self"; }
390 path = m->hasPath(it->second);
391 //if the user has not given a path then, add inputdir. else leave path alone.
392 if (path == "") { parameters["reference"] = inputDir + it->second; }
394 templatefile = validParameter.validFile(parameters, "reference", true);
395 if (templatefile == "not open") { abort = true; }
396 else if (templatefile == "not found") { //check for saved reference sequences
397 if (rdb->getSavedReference() != "") {
398 templatefile = rdb->getSavedReference();
399 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
401 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
402 m->mothurOutEndLine();
407 }else if (hasName) { templatefile = "self"; }
409 if (rdb->getSavedReference() != "") {
410 templatefile = rdb->getSavedReference();
411 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
413 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
414 m->mothurOutEndLine();
415 templatefile = ""; abort = true;
419 string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
420 m->setProcessors(temp);
421 convert(temp, processors);
423 abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
424 if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
426 temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; }
427 chimealns = m->isTrue(temp);
429 minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; }
430 mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; }
431 xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; }
432 dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; }
433 xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; }
434 chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
435 minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
436 idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
437 //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
438 maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
439 minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
440 maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
442 temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; }
443 ucl = m->isTrue(temp);
445 queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; }
446 if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; }
448 temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; }
449 skipgaps = m->isTrue(temp);
451 temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
452 skipgaps2 = m->isTrue(temp);
454 if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
455 if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
457 //look for uchime exe
459 string tempPath = path;
460 for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
461 path = path.substr(0, (tempPath.find_last_of('m')));
463 string uchimeCommand;
464 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
465 uchimeCommand = path + "uchime"; // format the database, -o option gives us the ability
467 uchimeCommand = path + "uchime.exe";
470 //test to make sure uchime exists
472 uchimeCommand = m->getFullPathName(uchimeCommand);
473 int ableToOpen = m->openInputFile(uchimeCommand, in, "no error"); in.close();
474 if(ableToOpen == 1) { m->mothurOut("[ERROR]: " + uchimeCommand + " file does not exist. mothur requires the uchime executable."); m->mothurOutEndLine(); abort = true; }
477 catch(exception& e) {
478 m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand");
482 //***************************************************************************************************************
484 int ChimeraUchimeCommand::execute(){
486 if (abort == true) { if (calledHelp) { return 0; } return 2; }
488 m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
490 for (int s = 0; s < fastaFileNames.size(); s++) {
492 m->mothurOut("Checking sequences from " + fastaFileNames[s] + " ..." ); m->mothurOutEndLine();
494 int start = time(NULL);
495 string nameFile = "";
496 if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
497 string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
498 string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
499 string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
500 string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
502 //you provided a groupfile
503 string groupFile = "";
504 if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; }
506 if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template
508 if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
509 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
510 nameFile = nameFileNames[s];
511 }else { nameFile = getNamesFile(fastaFileNames[s]); }
513 map<string, string> seqs;
514 readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
517 vector<seqPriorityNode> nameMapCount;
518 int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
519 if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
520 if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
522 printFile(nameMapCount, newFasta);
523 fastaFileNames[s] = newFasta;
526 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
528 if (groupFile != "") {
529 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
530 nameFile = nameFileNames[s];
531 }else { nameFile = getNamesFile(fastaFileNames[s]); }
533 //Parse sequences by group
534 SequenceParser parser(groupFile, fastaFileNames[s], nameFile);
535 vector<string> groups = parser.getNamesOfGroups();
537 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
540 ofstream out, out1, out2;
541 m->openOutputFile(outputFileName, out); out.close();
542 m->openOutputFile(accnosFileName, out1); out1.close();
543 if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
546 if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
547 else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); }
549 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
551 int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName);
553 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
554 m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
556 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
559 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
563 //#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
564 if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
565 else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
567 // numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras);
569 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
571 //remove file made for uchime
572 if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
574 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
577 outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
578 outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
579 if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
582 //set accnos file as new current accnosfile
584 itTypes = outputTypes.find("accnos");
585 if (itTypes != outputTypes.end()) {
586 if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setAccnosFile(current); }
589 m->mothurOutEndLine();
590 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
591 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
592 m->mothurOutEndLine();
597 catch(exception& e) {
598 m->errorOut(e, "ChimeraUchimeCommand", "execute");
602 //**********************************************************************************************************************
603 int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){
605 map<string, string> uniqueNames = parser.getAllSeqsMap();
606 map<string, string>::iterator itUnique;
611 m->openInputFile(accnosFileName, in2);
614 m->openOutputFile(accnosFileName+".temp", out2);
617 set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
618 set<string>::iterator itNames;
619 set<string> chimerasInFile;
620 set<string>::iterator itChimeras;
624 if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
626 in2 >> name; m->gobble(in2);
629 itUnique = uniqueNames.find(name);
631 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
633 itChimeras = chimerasInFile.find((itUnique->second));
635 if (itChimeras == chimerasInFile.end()) {
636 out2 << itUnique->second << endl;
637 chimerasInFile.insert((itUnique->second));
645 m->mothurRemove(accnosFileName);
646 rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
652 m->openInputFile(outputFileName, in);
655 m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
658 string parent1, parent2, temp2, temp3, temp4, temp5, temp6, temp7, temp8, temp9, temp10, temp11, temp12, temp13, flag;
661 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
662 /* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
663 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
664 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
669 if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
672 in >> temp1; m->gobble(in);
673 in >> name; m->gobble(in);
674 in >> parent1; m->gobble(in);
675 in >> parent2; m->gobble(in);
676 in >> temp2 >> temp3 >> temp4 >> temp5 >> temp6 >> temp7 >> temp8 >> temp9 >> temp10 >> temp11 >> temp12 >> temp13 >> flag;
679 //parse name - name will look like U68590/ab=1/
680 string restOfName = "";
681 int pos = name.find_first_of('/');
682 if (pos != string::npos) {
683 restOfName = name.substr(pos);
684 name = name.substr(0, pos);
688 itUnique = uniqueNames.find(name);
690 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
692 name = itUnique->second;
693 //is this name already in the file
694 itNames = namesInFile.find((name));
696 if (itNames == namesInFile.end()) { //no not in file
697 if (flag == "N") { //are you really a no??
698 //is this sequence really not chimeric??
699 itChimeras = chimerasInFile.find(name);
701 //then you really are a no so print, otherwise skip
702 if (itChimeras == chimerasInFile.end()) { print = true; }
703 }else{ print = true; }
708 out << temp1 << '\t' << name << restOfName << '\t';
709 namesInFile.insert(name);
711 //parse parent1 names
712 if (parent1 != "*") {
714 pos = parent1.find_first_of('/');
715 if (pos != string::npos) {
716 restOfName = parent1.substr(pos);
717 parent1 = parent1.substr(0, pos);
720 itUnique = uniqueNames.find(parent1);
721 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
722 else { out << itUnique->second << restOfName << '\t'; }
723 }else { out << parent1 << '\t'; }
725 //parse parent2 names
726 if (parent2 != "*") {
728 pos = parent2.find_first_of('/');
729 if (pos != string::npos) {
730 restOfName = parent2.substr(pos);
731 parent2 = parent2.substr(0, pos);
734 itUnique = uniqueNames.find(parent2);
735 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
736 else { out << itUnique->second << restOfName << '\t'; }
737 }else { out << parent2 << '\t'; }
739 out << temp2 << '\t' << temp3 << '\t' << temp4 << '\t' << temp5 << '\t' << temp6 << '\t' << temp7 << '\t' << temp8 << '\t' << temp9 << '\t' << temp10 << '\t' << temp11 << '\t' << temp12 << temp13 << '\t' << flag << endl;
745 m->mothurRemove(outputFileName);
746 rename((outputFileName+".temp").c_str(), outputFileName.c_str());
750 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
752 ------------------------------------------------------------------------
753 Query ( 179 nt) F21Fcsw_11639/ab=591/
754 ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
755 ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
757 A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
758 Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
759 B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
760 Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
761 Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
762 Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
764 A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
765 Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
766 B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
767 Diffs NNN N N N N N BB NNN
768 Votes 000 0 0 0 0 0 ++ 000
769 Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
771 A 159 TGGAACTGAGACACGGTCCAA 179
772 Q 159 TGGAACTGAGACACGGTCCAA 179
773 B 161 TGGAACTGAGACACGGTCCAA 181
776 Model BBBBBBBBBBBBBBBBBBBBB
778 Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
779 Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
783 m->openInputFile(alnsFileName, in3);
786 m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
793 if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
796 line = m->getline(in3);
800 istringstream iss(line);
803 //are you a name line
804 if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
806 for (int i = 0; i < line.length(); i++) {
808 if (line[i] == ')') { break; }
809 else { out3 << line[i]; }
812 if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
813 else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
815 out << line[spot] << line[spot+1];
817 name = line.substr(spot+2);
819 //parse name - name will either look like U68590/ab=1/ or U68590
820 string restOfName = "";
821 int pos = name.find_first_of('/');
822 if (pos != string::npos) {
823 restOfName = name.substr(pos);
824 name = name.substr(0, pos);
828 itUnique = uniqueNames.find(name);
830 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
832 //only limit repeats on query names
833 if (temp == "Query") {
834 itNames = namesInFile.find((itUnique->second));
836 if (itNames == namesInFile.end()) {
837 out << itUnique->second << restOfName << endl;
838 namesInFile.insert((itUnique->second));
840 }else { out << itUnique->second << restOfName << endl; }
845 }else { //not need to alter line
846 out3 << line << endl;
848 }else { out3 << endl; }
853 m->mothurRemove(alnsFileName);
854 rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
859 catch(exception& e) {
860 m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
864 //**********************************************************************************************************************
865 int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
868 sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
871 m->openOutputFile(filename, out);
873 //print new file in order of
874 for (int i = 0; i < nameMapCount.size(); i++) {
875 out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
881 catch(exception& e) {
882 m->errorOut(e, "ChimeraUchimeCommand", "printFile");
886 //**********************************************************************************************************************
887 int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
889 //create input file for uchime
890 //read through fastafile and store info
892 m->openInputFile(filename, in);
896 if (m->control_pressed) { in.close(); return 0; }
898 Sequence seq(in); m->gobble(in);
899 seqs[seq.getName()] = seq.getAligned();
905 catch(exception& e) {
906 m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
910 //**********************************************************************************************************************
912 string ChimeraUchimeCommand::getNamesFile(string& inputFile){
914 string nameFile = "";
916 m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
918 //use unique.seqs to create new name and fastafile
919 string inputString = "fasta=" + inputFile;
920 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
921 m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
923 Command* uniqueCommand = new DeconvoluteCommand(inputString);
924 uniqueCommand->execute();
926 map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
928 delete uniqueCommand;
930 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
932 nameFile = filenames["name"][0];
933 inputFile = filenames["fasta"][0];
937 catch(exception& e) {
938 m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
942 //**********************************************************************************************************************
943 int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
949 for (int i = start; i < end; i++) {
950 int start = time(NULL); if (m->control_pressed) { return 0; }
952 int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; }
954 int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
955 totalSeqs += numSeqs;
957 if (m->control_pressed) { return 0; }
959 //remove file made for uchime
960 m->mothurRemove(filename);
963 m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
964 m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
965 if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
967 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
973 catch(exception& e) {
974 m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
978 //**********************************************************************************************************************
980 int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
982 //to allow for spaces in the path
983 outputFName = "\"" + outputFName + "\"";
984 filename = "\"" + filename + "\"";
985 alns = "\"" + alns + "\"";
990 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
991 tempUchime= new char[10];
993 strncat(tempUchime, "./uchime ", 9);
995 tempUchime= new char[8];
997 strncat(tempUchime, "uchime ", 7);
999 cPara.push_back(tempUchime);
1001 char* tempIn = new char[8];
1002 *tempIn = '\0'; strncat(tempIn, "--input", 7);
1003 //strcpy(tempIn, "--input");
1004 cPara.push_back(tempIn);
1005 char* temp = new char[filename.length()+1];
1006 *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
1007 //strcpy(temp, filename.c_str());
1008 cPara.push_back(temp);
1010 //are you using a reference file
1011 if (templatefile != "self") {
1012 //add reference file
1013 char* tempRef = new char[5];
1014 //strcpy(tempRef, "--db");
1015 *tempRef = '\0'; strncat(tempRef, "--db", 4);
1016 cPara.push_back(tempRef);
1017 char* tempR = new char[templatefile.length()+1];
1018 //strcpy(tempR, templatefile.c_str());
1019 *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
1020 cPara.push_back(tempR);
1023 char* tempO = new char[12];
1024 *tempO = '\0'; strncat(tempO, "--uchimeout", 11);
1025 //strcpy(tempO, "--uchimeout");
1026 cPara.push_back(tempO);
1027 char* tempout = new char[outputFName.length()+1];
1028 //strcpy(tempout, outputFName.c_str());
1029 *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
1030 cPara.push_back(tempout);
1033 char* tempA = new char[13];
1034 *tempA = '\0'; strncat(tempA, "--uchimealns", 12);
1035 //strcpy(tempA, "--uchimealns");
1036 cPara.push_back(tempA);
1037 char* tempa = new char[alns.length()+1];
1038 //strcpy(tempa, alns.c_str());
1039 *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
1040 cPara.push_back(tempa);
1044 char* tempskew = new char[9];
1045 *tempskew = '\0'; strncat(tempskew, "--abskew", 8);
1046 //strcpy(tempskew, "--abskew");
1047 cPara.push_back(tempskew);
1048 char* tempSkew = new char[abskew.length()+1];
1049 //strcpy(tempSkew, abskew.c_str());
1050 *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
1051 cPara.push_back(tempSkew);
1055 char* tempminh = new char[7];
1056 *tempminh = '\0'; strncat(tempminh, "--minh", 6);
1057 //strcpy(tempminh, "--minh");
1058 cPara.push_back(tempminh);
1059 char* tempMinH = new char[minh.length()+1];
1060 *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
1061 //strcpy(tempMinH, minh.c_str());
1062 cPara.push_back(tempMinH);
1066 char* tempmindiv = new char[9];
1067 *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
1068 //strcpy(tempmindiv, "--mindiv");
1069 cPara.push_back(tempmindiv);
1070 char* tempMindiv = new char[mindiv.length()+1];
1071 *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
1072 //strcpy(tempMindiv, mindiv.c_str());
1073 cPara.push_back(tempMindiv);
1077 char* tempxn = new char[5];
1078 //strcpy(tempxn, "--xn");
1079 *tempxn = '\0'; strncat(tempxn, "--xn", 4);
1080 cPara.push_back(tempxn);
1081 char* tempXn = new char[xn.length()+1];
1082 //strcpy(tempXn, xn.c_str());
1083 *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
1084 cPara.push_back(tempXn);
1088 char* tempdn = new char[5];
1089 //strcpy(tempdn, "--dn");
1090 *tempdn = '\0'; strncat(tempdn, "--dn", 4);
1091 cPara.push_back(tempdn);
1092 char* tempDn = new char[dn.length()+1];
1093 *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
1094 //strcpy(tempDn, dn.c_str());
1095 cPara.push_back(tempDn);
1099 char* tempxa = new char[5];
1100 //strcpy(tempxa, "--xa");
1101 *tempxa = '\0'; strncat(tempxa, "--xa", 4);
1102 cPara.push_back(tempxa);
1103 char* tempXa = new char[xa.length()+1];
1104 *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
1105 //strcpy(tempXa, xa.c_str());
1106 cPara.push_back(tempXa);
1110 char* tempchunks = new char[9];
1111 //strcpy(tempchunks, "--chunks");
1112 *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
1113 cPara.push_back(tempchunks);
1114 char* tempChunks = new char[chunks.length()+1];
1115 *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
1116 //strcpy(tempChunks, chunks.c_str());
1117 cPara.push_back(tempChunks);
1121 char* tempminchunk = new char[11];
1122 //strcpy(tempminchunk, "--minchunk");
1123 *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
1124 cPara.push_back(tempminchunk);
1125 char* tempMinchunk = new char[minchunk.length()+1];
1126 *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
1127 //strcpy(tempMinchunk, minchunk.c_str());
1128 cPara.push_back(tempMinchunk);
1131 if (useIdsmoothwindow) {
1132 char* tempidsmoothwindow = new char[17];
1133 *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
1134 //strcpy(tempidsmoothwindow, "--idsmoothwindow");
1135 cPara.push_back(tempidsmoothwindow);
1136 char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
1137 *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
1138 //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
1139 cPara.push_back(tempIdsmoothwindow);
1142 /*if (useMinsmoothid) {
1143 char* tempminsmoothid = new char[14];
1144 //strcpy(tempminsmoothid, "--minsmoothid");
1145 *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
1146 cPara.push_back(tempminsmoothid);
1147 char* tempMinsmoothid = new char[minsmoothid.length()+1];
1148 *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
1149 //strcpy(tempMinsmoothid, minsmoothid.c_str());
1150 cPara.push_back(tempMinsmoothid);
1154 char* tempmaxp = new char[7];
1155 //strcpy(tempmaxp, "--maxp");
1156 *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
1157 cPara.push_back(tempmaxp);
1158 char* tempMaxp = new char[maxp.length()+1];
1159 *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
1160 //strcpy(tempMaxp, maxp.c_str());
1161 cPara.push_back(tempMaxp);
1165 char* tempskipgaps = new char[13];
1166 //strcpy(tempskipgaps, "--[no]skipgaps");
1167 *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
1168 cPara.push_back(tempskipgaps);
1172 char* tempskipgaps2 = new char[14];
1173 //strcpy(tempskipgaps2, "--[no]skipgaps2");
1174 *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
1175 cPara.push_back(tempskipgaps2);
1179 char* tempminlen = new char[9];
1180 *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
1181 //strcpy(tempminlen, "--minlen");
1182 cPara.push_back(tempminlen);
1183 char* tempMinlen = new char[minlen.length()+1];
1184 //strcpy(tempMinlen, minlen.c_str());
1185 *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
1186 cPara.push_back(tempMinlen);
1190 char* tempmaxlen = new char[9];
1191 //strcpy(tempmaxlen, "--maxlen");
1192 *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
1193 cPara.push_back(tempmaxlen);
1194 char* tempMaxlen = new char[maxlen.length()+1];
1195 *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
1196 //strcpy(tempMaxlen, maxlen.c_str());
1197 cPara.push_back(tempMaxlen);
1201 char* tempucl = new char[5];
1202 strcpy(tempucl, "--ucl");
1203 cPara.push_back(tempucl);
1206 if (useQueryfract) {
1207 char* tempqueryfract = new char[13];
1208 *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
1209 //strcpy(tempqueryfract, "--queryfract");
1210 cPara.push_back(tempqueryfract);
1211 char* tempQueryfract = new char[queryfract.length()+1];
1212 *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
1213 //strcpy(tempQueryfract, queryfract.c_str());
1214 cPara.push_back(tempQueryfract);
1218 char** uchimeParameters;
1219 uchimeParameters = new char*[cPara.size()];
1220 string commandString = "";
1221 for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; commandString += toString(cPara[i]) + " "; }
1222 //int numArgs = cPara.size();
1224 //uchime_main(numArgs, uchimeParameters);
1225 //cout << "commandString = " << commandString << endl;
1226 system(commandString.c_str());
1229 for(int i = 0; i < cPara.size(); i++) { delete cPara[i]; }
1230 delete[] uchimeParameters;
1232 //remove "" from filenames
1233 outputFName = outputFName.substr(1, outputFName.length()-2);
1234 filename = filename.substr(1, filename.length()-2);
1235 alns = alns.substr(1, alns.length()-2);
1237 if (m->control_pressed) { return 0; }
1239 //create accnos file from uchime results
1241 m->openInputFile(outputFName, in);
1244 m->openOutputFile(accnos, out);
1250 if (m->control_pressed) { break; }
1253 string chimeraFlag = "";
1254 in >> chimeraFlag >> name;
1256 //fix name if needed
1257 if (templatefile == "self") {
1258 name = name.substr(0, name.length()-1); //rip off last /
1259 name = name.substr(0, name.find_last_of('/'));
1262 for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
1265 if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
1273 catch(exception& e) {
1274 m->errorOut(e, "ChimeraUchimeCommand", "driver");
1278 /**************************************************************************************************/
1280 int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
1286 vector<string> files;
1288 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1289 //break up file into multiple files
1290 m->divideFile(filename, processors, files);
1292 if (m->control_pressed) { return 0; }
1294 //loop through and create all the processes you want
1295 while (process != processors) {
1299 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1301 }else if (pid == 0){
1302 num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
1304 //pass numSeqs to parent
1306 string tempFile = outputFileName + toString(getpid()) + ".num.temp";
1307 m->openOutputFile(tempFile, out);
1309 out << numChimeras << endl;
1314 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1315 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1321 num = driver(outputFileName, files[0], accnos, alns, numChimeras);
1323 //force parent to wait until all the processes are done
1324 for (int i=0;i<processIDS.size();i++) {
1325 int temp = processIDS[i];
1329 for (int i = 0; i < processIDS.size(); i++) {
1331 string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
1332 m->openInputFile(tempFile, in);
1335 in >> tempNum; m->gobble(in);
1338 numChimeras += tempNum;
1340 in.close(); m->mothurRemove(tempFile);
1343 //////////////////////////////////////////////////////////////////////////////////////////////////////
1344 //Windows version shared memory, so be careful when passing variables through the preClusterData struct.
1345 //Above fork() will clone, so memory is separate, but that's not the case with windows,
1346 //////////////////////////////////////////////////////////////////////////////////////////////////////
1351 map<int, ofstream*> filehandles;
1352 map<int, ofstream*>::iterator it3;
1355 for (int i = 0; i < processors; i++) {
1356 temp = new ofstream;
1357 filehandles[i] = temp;
1358 m->openOutputFile(filename+toString(i)+".temp", *(temp));
1359 files.push_back(filename+toString(i)+".temp");
1363 m->openInputFile(filename, in);
1367 if (m->control_pressed) { in.close(); for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) { (*(it3->second)).close(); delete it3->second; } return 0; }
1369 Sequence tempSeq(in); m->gobble(in);
1371 if (tempSeq.getName() != "") {
1372 tempSeq.printSequence(*(filehandles[spot]));
1374 if (spot == processors) { spot = 0; }
1380 for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) {
1381 (*(it3->second)).close();
1385 //sanity check for number of processors
1386 if (count < processors) { processors = count; }
1388 vector<uchimeData*> pDataArray;
1389 DWORD dwThreadIdArray[processors-1];
1390 HANDLE hThreadArray[processors-1];
1391 vector<string> dummy; //used so that we can use the same struct for MyUchimeSeqsThreadFunction and MyUchimeThreadFunction
1393 //Create processor worker threads.
1394 for( int i=1; i<processors; i++ ){
1395 // Allocate memory for thread data.
1396 string extension = toString(i) + ".temp";
1398 uchimeData* tempUchime = new uchimeData(outputFileName+extension, templatefile, files[i], "", "", "", accnos+extension, alns+extension, dummy, m, 0, 0, i);
1399 tempUchime->setBooleans(useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract);
1400 tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract);
1402 pDataArray.push_back(tempUchime);
1403 processIDS.push_back(i);
1405 //MySeqSumThreadFunction is in header. It must be global or static to work with the threads.
1406 //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
1407 hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeSeqsThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
1411 //using the main process as a worker saves time and memory
1412 num = driver(outputFileName, files[0], accnos, alns, numChimeras);
1414 //Wait until all threads have terminated.
1415 WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
1417 //Close all thread handles and free memory allocations.
1418 for(int i=0; i < pDataArray.size(); i++){
1419 num += pDataArray[i]->count;
1420 numChimeras += pDataArray[i]->numChimeras;
1421 CloseHandle(hThreadArray[i]);
1422 delete pDataArray[i];
1426 //append output files
1427 for(int i=0;i<processIDS.size();i++){
1428 m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
1429 m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
1431 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1432 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1435 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1436 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1440 //get rid of the file pieces.
1441 for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
1444 catch(exception& e) {
1445 m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
1449 /**************************************************************************************************/
1451 int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector<string> groups) {
1459 if (groups.size() < processors) { processors = groups.size(); }
1461 //divide the groups between the processors
1462 vector<linePair> lines;
1463 int numGroupsPerProcessor = groups.size() / processors;
1464 for (int i = 0; i < processors; i++) {
1465 int startIndex = i * numGroupsPerProcessor;
1466 int endIndex = (i+1) * numGroupsPerProcessor;
1467 if(i == (processors - 1)){ endIndex = groups.size(); }
1468 lines.push_back(linePair(startIndex, endIndex));
1471 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1473 //loop through and create all the processes you want
1474 while (process != processors) {
1478 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1480 }else if (pid == 0){
1481 num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
1483 //pass numSeqs to parent
1485 string tempFile = outputFName + toString(getpid()) + ".num.temp";
1486 m->openOutputFile(tempFile, out);
1492 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1493 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1499 num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
1501 //force parent to wait until all the processes are done
1502 for (int i=0;i<processIDS.size();i++) {
1503 int temp = processIDS[i];
1507 for (int i = 0; i < processIDS.size(); i++) {
1509 string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
1510 m->openInputFile(tempFile, in);
1511 if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
1512 in.close(); m->mothurRemove(tempFile);
1516 //////////////////////////////////////////////////////////////////////////////////////////////////////
1517 //Windows version shared memory, so be careful when passing variables through the uchimeData struct.
1518 //Above fork() will clone, so memory is separate, but that's not the case with windows,
1519 //////////////////////////////////////////////////////////////////////////////////////////////////////
1521 vector<uchimeData*> pDataArray;
1522 DWORD dwThreadIdArray[processors-1];
1523 HANDLE hThreadArray[processors-1];
1525 //Create processor worker threads.
1526 for( int i=1; i<processors; i++ ){
1527 // Allocate memory for thread data.
1528 string extension = toString(i) + ".temp";
1530 uchimeData* tempUchime = new uchimeData(outputFName+extension, templatefile, filename+extension, fastafile, namefile, groupfile, accnos+extension, alns+extension, groups, m, lines[i].start, lines[i].end, i);
1531 tempUchime->setBooleans(useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract);
1532 tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract);
1534 pDataArray.push_back(tempUchime);
1535 processIDS.push_back(i);
1537 //MyUchimeThreadFunction is in header. It must be global or static to work with the threads.
1538 //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
1539 hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
1543 //using the main process as a worker saves time and memory
1544 num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
1546 //Wait until all threads have terminated.
1547 WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
1549 //Close all thread handles and free memory allocations.
1550 for(int i=0; i < pDataArray.size(); i++){
1551 num += pDataArray[i]->count;
1552 CloseHandle(hThreadArray[i]);
1553 delete pDataArray[i];
1558 //append output files
1559 for(int i=0;i<processIDS.size();i++){
1560 m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
1561 m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
1563 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1564 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1567 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1568 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1575 catch(exception& e) {
1576 m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
1580 /**************************************************************************************************/