2 * chimerauchimecommand.cpp
5 * Created by westcott on 5/13/11.
6 * Copyright 2011 Schloss Lab. All rights reserved.
10 #include "chimerauchimecommand.h"
11 #include "deconvolutecommand.h"
13 #include "sequence.hpp"
14 #include "referencedb.h"
17 //**********************************************************************************************************************
18 vector<string> ChimeraUchimeCommand::setParameters(){
20 CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
21 CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
22 CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
23 CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup);
24 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
25 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
26 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
27 CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "",false,false); parameters.push_back(pabskew);
28 CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pchimealns);
29 CommandParameter pminh("minh", "Number", "", "0.3", "", "", "",false,false); parameters.push_back(pminh);
30 CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pmindiv);
31 CommandParameter pxn("xn", "Number", "", "8.0", "", "", "",false,false); parameters.push_back(pxn);
32 CommandParameter pdn("dn", "Number", "", "1.4", "", "", "",false,false); parameters.push_back(pdn);
33 CommandParameter pxa("xa", "Number", "", "1", "", "", "",false,false); parameters.push_back(pxa);
34 CommandParameter pchunks("chunks", "Number", "", "4", "", "", "",false,false); parameters.push_back(pchunks);
35 CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "",false,false); parameters.push_back(pminchunk);
36 CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "",false,false); parameters.push_back(pidsmoothwindow);
37 //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
38 CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "",false,false); parameters.push_back(pmaxp);
39 CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps);
40 CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps2);
41 CommandParameter pminlen("minlen", "Number", "", "10", "", "", "",false,false); parameters.push_back(pminlen);
42 CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "",false,false); parameters.push_back(pmaxlen);
43 CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pucl);
44 CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pqueryfract);
46 vector<string> myArray;
47 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
51 m->errorOut(e, "ChimeraUchimeCommand", "setParameters");
55 //**********************************************************************************************************************
56 string ChimeraUchimeCommand::getHelpString(){
58 string helpString = "";
59 helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
60 helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
61 helpString += "The chimera.uchime command parameters are fasta, name, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
62 helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
63 helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
64 helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
65 helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
66 helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
67 helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
68 helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
69 helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n";
70 helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n";
71 helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n";
72 helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n";
73 helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n";
74 helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n";
75 helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
76 helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
77 helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
78 //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
79 helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
80 helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
81 helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
82 helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n";
83 helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n";
84 helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n";
85 helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n";
87 helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n";
89 helpString += "The chimera.uchime command should be in the following format: \n";
90 helpString += "chimera.uchime(fasta=yourFastaFile, reference=yourTemplate) \n";
91 helpString += "Example: chimera.uchime(fasta=AD.align, reference=silva.gold.align) \n";
92 helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFastaFile).\n";
96 m->errorOut(e, "ChimeraUchimeCommand", "getHelpString");
100 //**********************************************************************************************************************
101 ChimeraUchimeCommand::ChimeraUchimeCommand(){
103 abort = true; calledHelp = true;
105 vector<string> tempOutNames;
106 outputTypes["chimera"] = tempOutNames;
107 outputTypes["accnos"] = tempOutNames;
108 outputTypes["alns"] = tempOutNames;
110 catch(exception& e) {
111 m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand");
115 //***************************************************************************************************************
116 ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
118 abort = false; calledHelp = false;
119 ReferenceDB* rdb = ReferenceDB::getInstance();
121 //allow user to run help
122 if(option == "help") { help(); abort = true; calledHelp = true; }
123 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
126 vector<string> myArray = setParameters();
128 OptionParser parser(option);
129 map<string,string> parameters = parser.getParameters();
131 ValidParameters validParameter("chimera.uchime");
132 map<string,string>::iterator it;
134 //check to make sure all parameters are valid for command
135 for (it = parameters.begin(); it != parameters.end(); it++) {
136 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
139 vector<string> tempOutNames;
140 outputTypes["chimera"] = tempOutNames;
141 outputTypes["accnos"] = tempOutNames;
142 outputTypes["alns"] = tempOutNames;
144 //if the user changes the input directory command factory will send this info to us in the output parameter
145 string inputDir = validParameter.validFile(parameters, "inputdir", false);
146 if (inputDir == "not found"){ inputDir = ""; }
148 //check for required parameters
149 fastafile = validParameter.validFile(parameters, "fasta", false);
150 if (fastafile == "not found") {
151 //if there is a current fasta file, use it
152 string filename = m->getFastaFile();
153 if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
154 else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
156 m->splitAtDash(fastafile, fastaFileNames);
158 //go through files and make sure they are good, if not, then disregard them
159 for (int i = 0; i < fastaFileNames.size(); i++) {
162 if (fastaFileNames[i] == "current") {
163 fastaFileNames[i] = m->getFastaFile();
164 if (fastaFileNames[i] != "") { m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine(); }
166 m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true;
167 //erase from file list
168 fastaFileNames.erase(fastaFileNames.begin()+i);
175 if (inputDir != "") {
176 string path = m->hasPath(fastaFileNames[i]);
177 //if the user has not given a path then, add inputdir. else leave path alone.
178 if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; }
184 ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror");
186 //if you can't open it, try default location
187 if (ableToOpen == 1) {
188 if (m->getDefaultPath() != "") { //default path is set
189 string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]);
190 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
192 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
194 fastaFileNames[i] = tryPath;
198 if (ableToOpen == 1) {
199 if (m->getOutputDir() != "") { //default path is set
200 string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]);
201 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
203 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
205 fastaFileNames[i] = tryPath;
211 if (ableToOpen == 1) {
212 m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
213 //erase from file list
214 fastaFileNames.erase(fastaFileNames.begin()+i);
217 m->setFastaFile(fastaFileNames[i]);
222 //make sure there is at least one valid file left
223 if (fastaFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid files."); m->mothurOutEndLine(); abort = true; }
227 //check for required parameters
229 namefile = validParameter.validFile(parameters, "name", false);
230 if (namefile == "not found") { namefile = ""; hasName = false; }
232 m->splitAtDash(namefile, nameFileNames);
234 //go through files and make sure they are good, if not, then disregard them
235 for (int i = 0; i < nameFileNames.size(); i++) {
238 if (nameFileNames[i] == "current") {
239 nameFileNames[i] = m->getNameFile();
240 if (nameFileNames[i] != "") { m->mothurOut("Using " + nameFileNames[i] + " as input file for the name parameter where you had given current."); m->mothurOutEndLine(); }
242 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
243 //erase from file list
244 nameFileNames.erase(nameFileNames.begin()+i);
251 if (inputDir != "") {
252 string path = m->hasPath(nameFileNames[i]);
253 //if the user has not given a path then, add inputdir. else leave path alone.
254 if (path == "") { nameFileNames[i] = inputDir + nameFileNames[i]; }
260 ableToOpen = m->openInputFile(nameFileNames[i], in, "noerror");
262 //if you can't open it, try default location
263 if (ableToOpen == 1) {
264 if (m->getDefaultPath() != "") { //default path is set
265 string tryPath = m->getDefaultPath() + m->getSimpleName(nameFileNames[i]);
266 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
268 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
270 nameFileNames[i] = tryPath;
274 if (ableToOpen == 1) {
275 if (m->getOutputDir() != "") { //default path is set
276 string tryPath = m->getOutputDir() + m->getSimpleName(nameFileNames[i]);
277 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
279 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
281 nameFileNames[i] = tryPath;
287 if (ableToOpen == 1) {
288 m->mothurOut("Unable to open " + nameFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
289 //erase from file list
290 nameFileNames.erase(nameFileNames.begin()+i);
293 m->setNameFile(nameFileNames[i]);
298 //make sure there is at least one valid file left
299 if (nameFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid name files."); m->mothurOutEndLine(); abort = true; }
302 if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
304 bool hasGroup = true;
305 groupfile = validParameter.validFile(parameters, "group", false);
306 if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
308 m->splitAtDash(groupfile, groupFileNames);
310 //go through files and make sure they are good, if not, then disregard them
311 for (int i = 0; i < groupFileNames.size(); i++) {
314 if (groupFileNames[i] == "current") {
315 groupFileNames[i] = m->getGroupFile();
316 if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
318 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
319 //erase from file list
320 groupFileNames.erase(groupFileNames.begin()+i);
327 if (inputDir != "") {
328 string path = m->hasPath(groupFileNames[i]);
329 //if the user has not given a path then, add inputdir. else leave path alone.
330 if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
336 ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
338 //if you can't open it, try default location
339 if (ableToOpen == 1) {
340 if (m->getDefaultPath() != "") { //default path is set
341 string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
342 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
344 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
346 groupFileNames[i] = tryPath;
350 if (ableToOpen == 1) {
351 if (m->getOutputDir() != "") { //default path is set
352 string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
353 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
355 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
357 groupFileNames[i] = tryPath;
363 if (ableToOpen == 1) {
364 m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
365 //erase from file list
366 groupFileNames.erase(groupFileNames.begin()+i);
369 m->setGroupFile(groupFileNames[i]);
374 //make sure there is at least one valid file left
375 if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
378 if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
381 //if the user changes the output directory command factory will send this info to us in the output parameter
382 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
385 it = parameters.find("reference");
386 //user has given a template file
387 if(it != parameters.end()){
388 if (it->second == "self") { templatefile = "self"; }
390 path = m->hasPath(it->second);
391 //if the user has not given a path then, add inputdir. else leave path alone.
392 if (path == "") { parameters["reference"] = inputDir + it->second; }
394 templatefile = validParameter.validFile(parameters, "reference", true);
395 if (templatefile == "not open") { abort = true; }
396 else if (templatefile == "not found") { //check for saved reference sequences
397 if (rdb->getSavedReference() != "") {
398 templatefile = rdb->getSavedReference();
399 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
401 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
402 m->mothurOutEndLine();
407 }else if (hasName) { templatefile = "self"; }
409 if (rdb->getSavedReference() != "") {
410 templatefile = rdb->getSavedReference();
411 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
413 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
414 m->mothurOutEndLine();
415 templatefile = ""; abort = true;
419 string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
420 m->setProcessors(temp);
421 convert(temp, processors);
423 abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
424 if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
426 temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; }
427 chimealns = m->isTrue(temp);
429 minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; }
430 mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; }
431 xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; }
432 dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; }
433 xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; }
434 chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
435 minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
436 idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
437 //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
438 maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
439 minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
440 maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
442 temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; }
443 ucl = m->isTrue(temp);
445 queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; }
446 if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; }
448 temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; }
449 skipgaps = m->isTrue(temp);
451 temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
452 skipgaps2 = m->isTrue(temp);
454 if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
455 if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
457 //look for uchime exe
459 string tempPath = path;
460 for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
461 path = path.substr(0, (tempPath.find_last_of('m')));
463 string uchimeCommand;
464 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
465 uchimeCommand = path + "uchime"; // format the database, -o option gives us the ability
467 uchimeCommand = path + "uchime.exe";
470 //test to make sure uchime exists
472 uchimeCommand = m->getFullPathName(uchimeCommand);
473 int ableToOpen = m->openInputFile(uchimeCommand, in, "no error"); in.close();
474 if(ableToOpen == 1) { m->mothurOut("[ERROR]: " + uchimeCommand + " file does not exist. mothur requires the uchime executable."); m->mothurOutEndLine(); abort = true; }
477 catch(exception& e) {
478 m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand");
482 //***************************************************************************************************************
484 int ChimeraUchimeCommand::execute(){
486 if (abort == true) { if (calledHelp) { return 0; } return 2; }
488 m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
490 for (int s = 0; s < fastaFileNames.size(); s++) {
492 m->mothurOut("Checking sequences from " + fastaFileNames[s] + " ..." ); m->mothurOutEndLine();
494 int start = time(NULL);
495 string nameFile = "";
496 if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
497 string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
498 string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
499 string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
500 string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
502 //you provided a groupfile
503 string groupFile = "";
504 if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; }
506 if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template
508 if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
509 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
510 nameFile = nameFileNames[s];
511 }else { nameFile = getNamesFile(fastaFileNames[s]); }
513 map<string, string> seqs;
514 readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
517 vector<seqPriorityNode> nameMapCount;
518 int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
519 if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
520 if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
522 printFile(nameMapCount, newFasta);
523 fastaFileNames[s] = newFasta;
526 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
528 if (groupFile != "") {
529 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
530 nameFile = nameFileNames[s];
531 }else { nameFile = getNamesFile(fastaFileNames[s]); }
533 //Parse sequences by group
534 SequenceParser parser(groupFile, fastaFileNames[s], nameFile);
535 vector<string> groups = parser.getNamesOfGroups();
537 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
540 ofstream out, out1, out2;
541 m->openOutputFile(outputFileName, out); out.close();
542 m->openOutputFile(accnosFileName, out1); out1.close();
543 if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
546 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
547 if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
548 else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); }
550 totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups);
552 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
554 int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName);
556 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
557 m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
559 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
562 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
566 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
567 if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
568 else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
570 numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras);
572 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
574 //remove file made for uchime
575 if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
577 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
580 outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
581 outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
582 if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
585 //set accnos file as new current accnosfile
587 itTypes = outputTypes.find("accnos");
588 if (itTypes != outputTypes.end()) {
589 if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setAccnosFile(current); }
592 m->mothurOutEndLine();
593 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
594 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
595 m->mothurOutEndLine();
600 catch(exception& e) {
601 m->errorOut(e, "ChimeraUchimeCommand", "execute");
605 //**********************************************************************************************************************
606 int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){
608 map<string, string> uniqueNames = parser.getAllSeqsMap();
609 map<string, string>::iterator itUnique;
614 m->openInputFile(accnosFileName, in2);
617 m->openOutputFile(accnosFileName+".temp", out2);
620 set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
621 set<string>::iterator itNames;
622 set<string> chimerasInFile;
623 set<string>::iterator itChimeras;
627 if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
629 in2 >> name; m->gobble(in2);
632 itUnique = uniqueNames.find(name);
634 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
636 itChimeras = chimerasInFile.find((itUnique->second));
638 if (itChimeras == chimerasInFile.end()) {
639 out2 << itUnique->second << endl;
640 chimerasInFile.insert((itUnique->second));
648 m->mothurRemove(accnosFileName);
649 rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
655 m->openInputFile(outputFileName, in);
658 m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
661 string parent1, parent2, temp2, temp3, temp4, temp5, temp6, temp7, temp8, temp9, temp10, temp11, temp12, temp13, flag;
664 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
665 /* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
666 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
667 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
672 if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
675 in >> temp1; m->gobble(in);
676 in >> name; m->gobble(in);
677 in >> parent1; m->gobble(in);
678 in >> parent2; m->gobble(in);
679 in >> temp2 >> temp3 >> temp4 >> temp5 >> temp6 >> temp7 >> temp8 >> temp9 >> temp10 >> temp11 >> temp12 >> temp13 >> flag;
682 //parse name - name will look like U68590/ab=1/
683 string restOfName = "";
684 int pos = name.find_first_of('/');
685 if (pos != string::npos) {
686 restOfName = name.substr(pos);
687 name = name.substr(0, pos);
691 itUnique = uniqueNames.find(name);
693 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
695 name = itUnique->second;
696 //is this name already in the file
697 itNames = namesInFile.find((name));
699 if (itNames == namesInFile.end()) { //no not in file
700 if (flag == "N") { //are you really a no??
701 //is this sequence really not chimeric??
702 itChimeras = chimerasInFile.find(name);
704 //then you really are a no so print, otherwise skip
705 if (itChimeras == chimerasInFile.end()) { print = true; }
706 }else{ print = true; }
711 out << temp1 << '\t' << name << restOfName << '\t';
712 namesInFile.insert(name);
714 //parse parent1 names
715 if (parent1 != "*") {
717 pos = parent1.find_first_of('/');
718 if (pos != string::npos) {
719 restOfName = parent1.substr(pos);
720 parent1 = parent1.substr(0, pos);
723 itUnique = uniqueNames.find(parent1);
724 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
725 else { out << itUnique->second << restOfName << '\t'; }
726 }else { out << parent1 << '\t'; }
728 //parse parent2 names
729 if (parent2 != "*") {
731 pos = parent2.find_first_of('/');
732 if (pos != string::npos) {
733 restOfName = parent2.substr(pos);
734 parent2 = parent2.substr(0, pos);
737 itUnique = uniqueNames.find(parent2);
738 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
739 else { out << itUnique->second << restOfName << '\t'; }
740 }else { out << parent2 << '\t'; }
742 out << temp2 << '\t' << temp3 << '\t' << temp4 << '\t' << temp5 << '\t' << temp6 << '\t' << temp7 << '\t' << temp8 << '\t' << temp9 << '\t' << temp10 << '\t' << temp11 << '\t' << temp12 << temp13 << '\t' << flag << endl;
748 m->mothurRemove(outputFileName);
749 rename((outputFileName+".temp").c_str(), outputFileName.c_str());
753 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
755 ------------------------------------------------------------------------
756 Query ( 179 nt) F21Fcsw_11639/ab=591/
757 ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
758 ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
760 A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
761 Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
762 B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
763 Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
764 Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
765 Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
767 A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
768 Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
769 B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
770 Diffs NNN N N N N N BB NNN
771 Votes 000 0 0 0 0 0 ++ 000
772 Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
774 A 159 TGGAACTGAGACACGGTCCAA 179
775 Q 159 TGGAACTGAGACACGGTCCAA 179
776 B 161 TGGAACTGAGACACGGTCCAA 181
779 Model BBBBBBBBBBBBBBBBBBBBB
781 Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
782 Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
786 m->openInputFile(alnsFileName, in3);
789 m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
796 if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
799 line = m->getline(in3);
803 istringstream iss(line);
806 //are you a name line
807 if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
809 for (int i = 0; i < line.length(); i++) {
811 if (line[i] == ')') { break; }
812 else { out3 << line[i]; }
815 if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
816 else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
818 out << line[spot] << line[spot+1];
820 name = line.substr(spot+2);
822 //parse name - name will either look like U68590/ab=1/ or U68590
823 string restOfName = "";
824 int pos = name.find_first_of('/');
825 if (pos != string::npos) {
826 restOfName = name.substr(pos);
827 name = name.substr(0, pos);
831 itUnique = uniqueNames.find(name);
833 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
835 //only limit repeats on query names
836 if (temp == "Query") {
837 itNames = namesInFile.find((itUnique->second));
839 if (itNames == namesInFile.end()) {
840 out << itUnique->second << restOfName << endl;
841 namesInFile.insert((itUnique->second));
843 }else { out << itUnique->second << restOfName << endl; }
848 }else { //not need to alter line
849 out3 << line << endl;
851 }else { out3 << endl; }
856 m->mothurRemove(alnsFileName);
857 rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
862 catch(exception& e) {
863 m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
867 //**********************************************************************************************************************
868 int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
871 sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
874 m->openOutputFile(filename, out);
876 //print new file in order of
877 for (int i = 0; i < nameMapCount.size(); i++) {
878 out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
884 catch(exception& e) {
885 m->errorOut(e, "ChimeraUchimeCommand", "printFile");
889 //**********************************************************************************************************************
890 int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
892 //create input file for uchime
893 //read through fastafile and store info
895 m->openInputFile(filename, in);
899 if (m->control_pressed) { in.close(); return 0; }
901 Sequence seq(in); m->gobble(in);
902 seqs[seq.getName()] = seq.getAligned();
908 catch(exception& e) {
909 m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
913 //**********************************************************************************************************************
915 string ChimeraUchimeCommand::getNamesFile(string& inputFile){
917 string nameFile = "";
919 m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
921 //use unique.seqs to create new name and fastafile
922 string inputString = "fasta=" + inputFile;
923 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
924 m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
926 Command* uniqueCommand = new DeconvoluteCommand(inputString);
927 uniqueCommand->execute();
929 map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
931 delete uniqueCommand;
933 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
935 nameFile = filenames["name"][0];
936 inputFile = filenames["fasta"][0];
940 catch(exception& e) {
941 m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
945 //**********************************************************************************************************************
946 int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
952 for (int i = start; i < end; i++) {
953 int start = time(NULL); if (m->control_pressed) { return 0; }
955 int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; }
957 int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
958 totalSeqs += numSeqs;
960 if (m->control_pressed) { return 0; }
962 //remove file made for uchime
963 m->mothurRemove(filename);
966 m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
967 m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
968 if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
970 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
976 catch(exception& e) {
977 m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
981 //**********************************************************************************************************************
983 int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
985 //to allow for spaces in the path
986 outputFName = "\"" + outputFName + "\"";
987 filename = "\"" + filename + "\"";
988 alns = "\"" + alns + "\"";
993 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
994 tempUchime= new char[10];
996 strncat(tempUchime, "./uchime ", 9);
998 tempUchime= new char[8];
1000 strncat(tempUchime, "uchime ", 7);
1002 cPara.push_back(tempUchime);
1004 char* tempIn = new char[8];
1005 *tempIn = '\0'; strncat(tempIn, "--input", 7);
1006 //strcpy(tempIn, "--input");
1007 cPara.push_back(tempIn);
1008 char* temp = new char[filename.length()+1];
1009 *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
1010 //strcpy(temp, filename.c_str());
1011 cPara.push_back(temp);
1013 //are you using a reference file
1014 if (templatefile != "self") {
1015 //add reference file
1016 char* tempRef = new char[5];
1017 //strcpy(tempRef, "--db");
1018 *tempRef = '\0'; strncat(tempRef, "--db", 4);
1019 cPara.push_back(tempRef);
1020 char* tempR = new char[templatefile.length()+1];
1021 //strcpy(tempR, templatefile.c_str());
1022 *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
1023 cPara.push_back(tempR);
1026 char* tempO = new char[12];
1027 *tempO = '\0'; strncat(tempO, "--uchimeout", 11);
1028 //strcpy(tempO, "--uchimeout");
1029 cPara.push_back(tempO);
1030 char* tempout = new char[outputFName.length()+1];
1031 //strcpy(tempout, outputFName.c_str());
1032 *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
1033 cPara.push_back(tempout);
1036 char* tempA = new char[13];
1037 *tempA = '\0'; strncat(tempA, "--uchimealns", 12);
1038 //strcpy(tempA, "--uchimealns");
1039 cPara.push_back(tempA);
1040 char* tempa = new char[alns.length()+1];
1041 //strcpy(tempa, alns.c_str());
1042 *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
1043 cPara.push_back(tempa);
1047 char* tempskew = new char[9];
1048 *tempskew = '\0'; strncat(tempskew, "--abskew", 8);
1049 //strcpy(tempskew, "--abskew");
1050 cPara.push_back(tempskew);
1051 char* tempSkew = new char[abskew.length()+1];
1052 //strcpy(tempSkew, abskew.c_str());
1053 *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
1054 cPara.push_back(tempSkew);
1058 char* tempminh = new char[7];
1059 *tempminh = '\0'; strncat(tempminh, "--minh", 6);
1060 //strcpy(tempminh, "--minh");
1061 cPara.push_back(tempminh);
1062 char* tempMinH = new char[minh.length()+1];
1063 *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
1064 //strcpy(tempMinH, minh.c_str());
1065 cPara.push_back(tempMinH);
1069 char* tempmindiv = new char[9];
1070 *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
1071 //strcpy(tempmindiv, "--mindiv");
1072 cPara.push_back(tempmindiv);
1073 char* tempMindiv = new char[mindiv.length()+1];
1074 *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
1075 //strcpy(tempMindiv, mindiv.c_str());
1076 cPara.push_back(tempMindiv);
1080 char* tempxn = new char[5];
1081 //strcpy(tempxn, "--xn");
1082 *tempxn = '\0'; strncat(tempxn, "--xn", 4);
1083 cPara.push_back(tempxn);
1084 char* tempXn = new char[xn.length()+1];
1085 //strcpy(tempXn, xn.c_str());
1086 *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
1087 cPara.push_back(tempXn);
1091 char* tempdn = new char[5];
1092 //strcpy(tempdn, "--dn");
1093 *tempdn = '\0'; strncat(tempdn, "--dn", 4);
1094 cPara.push_back(tempdn);
1095 char* tempDn = new char[dn.length()+1];
1096 *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
1097 //strcpy(tempDn, dn.c_str());
1098 cPara.push_back(tempDn);
1102 char* tempxa = new char[5];
1103 //strcpy(tempxa, "--xa");
1104 *tempxa = '\0'; strncat(tempxa, "--xa", 4);
1105 cPara.push_back(tempxa);
1106 char* tempXa = new char[xa.length()+1];
1107 *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
1108 //strcpy(tempXa, xa.c_str());
1109 cPara.push_back(tempXa);
1113 char* tempchunks = new char[9];
1114 //strcpy(tempchunks, "--chunks");
1115 *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
1116 cPara.push_back(tempchunks);
1117 char* tempChunks = new char[chunks.length()+1];
1118 *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
1119 //strcpy(tempChunks, chunks.c_str());
1120 cPara.push_back(tempChunks);
1124 char* tempminchunk = new char[11];
1125 //strcpy(tempminchunk, "--minchunk");
1126 *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
1127 cPara.push_back(tempminchunk);
1128 char* tempMinchunk = new char[minchunk.length()+1];
1129 *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
1130 //strcpy(tempMinchunk, minchunk.c_str());
1131 cPara.push_back(tempMinchunk);
1134 if (useIdsmoothwindow) {
1135 char* tempidsmoothwindow = new char[17];
1136 *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
1137 //strcpy(tempidsmoothwindow, "--idsmoothwindow");
1138 cPara.push_back(tempidsmoothwindow);
1139 char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
1140 *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
1141 //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
1142 cPara.push_back(tempIdsmoothwindow);
1145 /*if (useMinsmoothid) {
1146 char* tempminsmoothid = new char[14];
1147 //strcpy(tempminsmoothid, "--minsmoothid");
1148 *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
1149 cPara.push_back(tempminsmoothid);
1150 char* tempMinsmoothid = new char[minsmoothid.length()+1];
1151 *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
1152 //strcpy(tempMinsmoothid, minsmoothid.c_str());
1153 cPara.push_back(tempMinsmoothid);
1157 char* tempmaxp = new char[7];
1158 //strcpy(tempmaxp, "--maxp");
1159 *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
1160 cPara.push_back(tempmaxp);
1161 char* tempMaxp = new char[maxp.length()+1];
1162 *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
1163 //strcpy(tempMaxp, maxp.c_str());
1164 cPara.push_back(tempMaxp);
1168 char* tempskipgaps = new char[13];
1169 //strcpy(tempskipgaps, "--[no]skipgaps");
1170 *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
1171 cPara.push_back(tempskipgaps);
1175 char* tempskipgaps2 = new char[14];
1176 //strcpy(tempskipgaps2, "--[no]skipgaps2");
1177 *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
1178 cPara.push_back(tempskipgaps2);
1182 char* tempminlen = new char[9];
1183 *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
1184 //strcpy(tempminlen, "--minlen");
1185 cPara.push_back(tempminlen);
1186 char* tempMinlen = new char[minlen.length()+1];
1187 //strcpy(tempMinlen, minlen.c_str());
1188 *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
1189 cPara.push_back(tempMinlen);
1193 char* tempmaxlen = new char[9];
1194 //strcpy(tempmaxlen, "--maxlen");
1195 *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
1196 cPara.push_back(tempmaxlen);
1197 char* tempMaxlen = new char[maxlen.length()+1];
1198 *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
1199 //strcpy(tempMaxlen, maxlen.c_str());
1200 cPara.push_back(tempMaxlen);
1204 char* tempucl = new char[5];
1205 strcpy(tempucl, "--ucl");
1206 cPara.push_back(tempucl);
1209 if (useQueryfract) {
1210 char* tempqueryfract = new char[13];
1211 *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
1212 //strcpy(tempqueryfract, "--queryfract");
1213 cPara.push_back(tempqueryfract);
1214 char* tempQueryfract = new char[queryfract.length()+1];
1215 *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
1216 //strcpy(tempQueryfract, queryfract.c_str());
1217 cPara.push_back(tempQueryfract);
1221 char** uchimeParameters;
1222 uchimeParameters = new char*[cPara.size()];
1223 string commandString = "";
1224 for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; commandString += toString(cPara[i]) + " "; }
1225 //int numArgs = cPara.size();
1227 //uchime_main(numArgs, uchimeParameters);
1228 //cout << "commandString = " << commandString << endl;
1229 system(commandString.c_str());
1232 for(int i = 0; i < cPara.size(); i++) { delete cPara[i]; }
1233 delete[] uchimeParameters;
1235 //remove "" from filenames
1236 outputFName = outputFName.substr(1, outputFName.length()-2);
1237 filename = filename.substr(1, filename.length()-2);
1238 alns = alns.substr(1, alns.length()-2);
1240 if (m->control_pressed) { return 0; }
1242 //create accnos file from uchime results
1244 m->openInputFile(outputFName, in);
1247 m->openOutputFile(accnos, out);
1253 if (m->control_pressed) { break; }
1256 string chimeraFlag = "";
1257 in >> chimeraFlag >> name;
1259 //fix name if needed
1260 if (templatefile == "self") {
1261 name = name.substr(0, name.length()-1); //rip off last /
1262 name = name.substr(0, name.find_last_of('/'));
1265 for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
1268 if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
1276 catch(exception& e) {
1277 m->errorOut(e, "ChimeraUchimeCommand", "driver");
1281 /**************************************************************************************************/
1283 int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
1289 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1290 //break up file into multiple files
1291 vector<string> files;
1292 m->divideFile(filename, processors, files);
1294 if (m->control_pressed) { return 0; }
1296 //loop through and create all the processes you want
1297 while (process != processors) {
1301 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1303 }else if (pid == 0){
1304 num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
1306 //pass numSeqs to parent
1308 string tempFile = outputFileName + toString(getpid()) + ".num.temp";
1309 m->openOutputFile(tempFile, out);
1311 out << numChimeras << endl;
1316 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1317 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1323 num = driver(outputFileName, files[0], accnos, alns, numChimeras);
1325 //force parent to wait until all the processes are done
1326 for (int i=0;i<processIDS.size();i++) {
1327 int temp = processIDS[i];
1331 for (int i = 0; i < processIDS.size(); i++) {
1333 string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
1334 m->openInputFile(tempFile, in);
1337 in >> tempNum; m->gobble(in);
1340 numChimeras += tempNum;
1342 in.close(); m->mothurRemove(tempFile);
1346 //append output files
1347 for(int i=0;i<processIDS[i];i++){
1348 m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
1349 m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
1351 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1352 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1355 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1356 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1360 //get rid of the file pieces.
1361 for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
1365 catch(exception& e) {
1366 m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
1370 /**************************************************************************************************/
1372 int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector<string> groups) {
1380 if (groups.size() < processors) { processors = groups.size(); }
1382 //divide the groups between the processors
1383 vector<linePair> lines;
1384 int numGroupsPerProcessor = groups.size() / processors;
1385 for (int i = 0; i < processors; i++) {
1386 int startIndex = i * numGroupsPerProcessor;
1387 int endIndex = (i+1) * numGroupsPerProcessor;
1388 if(i == (processors - 1)){ endIndex = groups.size(); }
1389 lines.push_back(linePair(startIndex, endIndex));
1392 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1394 //loop through and create all the processes you want
1395 while (process != processors) {
1399 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1401 }else if (pid == 0){
1402 num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
1404 //pass numSeqs to parent
1406 string tempFile = outputFName + toString(getpid()) + ".num.temp";
1407 m->openOutputFile(tempFile, out);
1413 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1414 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1420 num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
1422 //force parent to wait until all the processes are done
1423 for (int i=0;i<processIDS.size();i++) {
1424 int temp = processIDS[i];
1429 for (int i = 0; i < processIDS.size(); i++) {
1431 string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
1432 m->openInputFile(tempFile, in);
1433 if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
1434 in.close(); m->mothurRemove(tempFile);
1438 //append output files
1439 for(int i=0;i<processIDS[i];i++){
1440 m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
1441 m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
1443 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1444 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1447 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1448 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1455 catch(exception& e) {
1456 m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
1460 /**************************************************************************************************/