revised KISS format

git-svn-id: http://biopieces.googlecode.com/svn/trunk@710 74ccb610-7750-0410-82ae-013aeee3265d

diff --git a/bp_bin/upload_to_KISS b/bp_bin/upload_to_KISS
index c03070855a6be4b2586db3ecf93c5d17d95401a9..28ccde31fb367c3fd99fd64541cc5d530388517b 100755 (executable)
--- a/bp_bin/upload_to_KISS
+++ b/bp_bin/upload_to_KISS
@@ -130,8 +130,6 @@ sub bulk_load_file
 
     my ( $sql );
 
-    #LOAD DATA INFILE....(col1, @dummy) SET col2 = IF(@dummy = '.', NULL, @dummy)
-
     $sql = qq(LOAD DATA LOCAL INFILE "$file" INTO TABLE $table);
 
     print STDERR "$sql\n" if $verbose;
@@ -167,6 +165,7 @@ sub create_table
         "BLOCK_COUNT TINYINT, INDEX BLOCK_COUNT_index (BLOCK_COUNT)",
         "BLOCK_BEGS VARCHAR(1024)",
         "BLOCK_LENS VARCHAR(1024)",
+        "BLOCK_TYPE VARCHAR(1024)",
     );
 
     $field_str = join( ", ", @fields ); 

diff --git a/code_perl/Maasha/KISS/Draw.pm b/code_perl/Maasha/KISS/Draw.pm
index df21300527b1451ee333d901ee5988625b0e3176..100b330e3e320278b5c38fec6d98c3aba40070d9 100644 (file)
--- a/code_perl/Maasha/KISS/Draw.pm
+++ b/code_perl/Maasha/KISS/Draw.pm
@@ -102,7 +102,39 @@ sub svg_frame
 
 sub svg_track_dna
 {
+    # Martin A. Hansen, October 2009.
+
+    # Given a DNA sequence as a list add a string
+    # of chars to a SVG object.
+
+    my ( $width,   # width
+         $svg,     # SVG object
+         $dna,
+       ) = @_;
+
+    # Returns nothing.
+
+    my ( $track );
 
+    $dna = 'GAACGACGAGCATCAGCGGACACTACATCATATACTACATC';
+
+    $track = $svg->group(
+        id => 'TRACK_DNA',
+        style => {
+         #   'stroke-width' => 5,
+         #   stroke         => 'black',   # TODO can this be removed?
+            'font-family'       => 'Courier New',
+            'font-size'         => '15px',
+            'letter-spacing'    => '15',
+        }
+    );
+
+    $track->text(
+        id => 'DNA',
+        x  => 0,
+        y  => 20,
+        -cdata => $dna,
+    );
 }
 
 

diff --git a/code_perl/Maasha/KISS/IO.pm b/code_perl/Maasha/KISS/IO.pm
index 7276f0a85c1a642ce43355a1f558465265e1edb0..5ff6a513f291535a3e34de55e22061b79e2b4085 100644 (file)
--- a/code_perl/Maasha/KISS/IO.pm
+++ b/code_perl/Maasha/KISS/IO.pm
@@ -49,6 +49,7 @@ use constant {
     BLOCK_COUNT => 8,
     BLOCK_BEGS  => 9,
     BLOCK_LENS  => 10,
+    BLOCK_TYPE  => 11,
 };
 
 #      0         1         2
@@ -68,9 +69,10 @@ use constant {
 #    BLOCK_COUNT => 2
 #    BLOCK_BEGS  => 1,6
 #    BLOCK_LENS  => 3,3
+#    BLOCK_TYPE  => 1,1
 #
 #
-# 'S.aur complete genome'   3   12  'TAG_000001'    1   +   31   2   1,6 3,3
+# 'S.aur complete genome'   3   12  'TAG_000001'    1   +   31   2   1,6 3,3    1,1
 
 
 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
@@ -93,7 +95,7 @@ sub kiss_entry_get
 
         @fields = split /\t/, $line;
 
-        Maasha::Common::error( qq( BAD kiss entry: $line) ) if not @fields == 11;
+        Maasha::Common::error( qq( BAD kiss entry: $line) ) if not @fields == 12;
         
         $entry{ 'S_ID' }        = $fields[ S_ID ];
         $entry{ 'S_BEG' }       = $fields[ S_BEG ];
@@ -106,6 +108,7 @@ sub kiss_entry_get
         $entry{ 'BLOCK_COUNT' } = $fields[ BLOCK_COUNT ];
         $entry{ 'BLOCK_BEGS' }  = $fields[ BLOCK_BEGS ];
         $entry{ 'BLOCK_LENS' }  = $fields[ BLOCK_LENS ];
+        $entry{ 'BLOCK_TYPE' }  = $fields[ BLOCK_TYPE ];
 
         return wantarray ? %entry : \%entry;
     }
@@ -124,17 +127,18 @@ sub kiss_entry_put
 
     $fh ||= \*STDOUT;
 
-    $fields[ S_ID ]   = $entry->{ 'S_ID' };
-    $fields[ S_BEG ]  = $entry->{ 'S_BEG' };
-    $fields[ S_END ]  = $entry->{ 'S_END' };
-    $fields[ Q_ID ]   = $entry->{ 'Q_ID' };
-    $fields[ SCORE ]  = $entry->{ 'SCORE' };
-    $fields[ STRAND ] = $entry->{ 'STRAND' };
-    $fields[ HITS ]   = $entry->{ 'HITS' };
-    $fields[ ALIGN ]  = $entry->{ 'ALIGN' };
+    $fields[ S_ID ]        = $entry->{ 'S_ID' };
+    $fields[ S_BEG ]       = $entry->{ 'S_BEG' };
+    $fields[ S_END ]       = $entry->{ 'S_END' };
+    $fields[ Q_ID ]        = $entry->{ 'Q_ID' };
+    $fields[ SCORE ]       = $entry->{ 'SCORE' };
+    $fields[ STRAND ]      = $entry->{ 'STRAND' };
+    $fields[ HITS ]        = $entry->{ 'HITS' };
+    $fields[ ALIGN ]       = $entry->{ 'ALIGN' };
     $fields[ BLOCK_COUNT ] = $entry->{ 'BLOCK_COUNT' };
     $fields[ BLOCK_BEGS ]  = $entry->{ 'BLOCK_BEGS' };
     $fields[ BLOCK_LENS ]  = $entry->{ 'BLOCK_LENS' };
+    $fields[ BLOCK_TYPE ]  = $entry->{ 'BLOCK_TYPE' };
 
     print $fh join( "\t", @fields ), "\n";
 }
@@ -176,6 +180,7 @@ sub biopiece2kiss
     $record->{ 'BLOCK_COUNT' } ||= ".";
     $record->{ 'BLOCK_BEGS' }  ||= ".";
     $record->{ 'BLOCK_LENS' }  ||= ".";
+    $record->{ 'BLOCK_TYPE' }  ||= ".";
     $record->{ 'ALIGN' }       ||= $record->{ 'DESCRIPTOR' } || ".";
 
     return wantarray ? %{ $record } : $record;

diff --git a/www/cgi-bin/index.cgi b/www/cgi-bin/index.cgi
index 525dfd1cfb8c29908674e7e80e7e0e16c744210a..f2e646098a53dddee48eaf484b821407da506065 100755 (executable)
--- a/www/cgi-bin/index.cgi
+++ b/www/cgi-bin/index.cgi
@@ -192,6 +192,8 @@ sub sec_browse
     $t0 = Time::HiRes::gettimeofday();
     Maasha::KISS::Draw::svg_frame( 800, 1200, $svg );
 
+    Maasha::KISS::Draw::svg_track_dna( 1200, $svg, 'dna', 'ATCG' );
+
     if ( @$entries > $MAX ) {
         Maasha::KISS::Draw::svg_track_histogram( $svg, $features, 'track id', 'green' ) if $features;
     } else {