File.rename "#{@infile}.sort", @infile
end
+ # Method to execute clustering de novo.
+ def cluster
+ @command << "usearch --cluster #{@infile} --uc #{@outfile} --id #{@options[:identity]}"
+
+ execute
+ end
+
# Method to execute database search.
def usearch
# usearch --query query.fasta --db db.fasta --uc results.uc --id 0.90 [--evalue E]
execute
end
- # Method to execute clustering de novo.
- def cluster
- @command << "usearch --cluster #{@infile} --uc #{@outfile} --id #{@options[:identity]}"
-
- execute
- end
-
# Method to execute clustering to database plus de novo if not matched.
def usearch_uclust
# usearch --cluster seqs_sorted.fasta --db db.fasta --uc results.uc --id 0.90
end
end
-ok_methods = "usearch,uclust,usearch_uclust"
+ok_methods = "uclust,usearch,usearch_uclust"
casts = []
casts << {:long=>'no_sort', :short=>'n', :type=>'flag', :mandatory=>false, :default=>nil, :allowed=>nil, :disallowed=>nil}
options = Biopieces.options_parse(ARGV, casts)
+# At high identities, around 96% and above, compressed indexes are often more sensitive, faster
+# and use less RAM. Compressed indexes are disabled by default, so I generally recommend that
+# you specify the --slots and --w options when clustering at high identities.
+
tmpdir = Biopieces.mktmpdir
infile = File.join(tmpdir, "in.fna")
outfile = File.join(tmpdir, "out.uc")
end
uclust = Uclust.new(infile, outfile, options)
- uclust.sort unless options[:no_sort]
+ uclust.sort unless options[:no_sort] or options[:method] == "usearch"
case options[:method].to_s
- when "usearch" then uclust.usearch
when "uclust" then uclust.cluster
+ when "usearch" then uclust.usearch
when "usearch_uclust" then uclust.usearch_uclust
- else raise "Unknown method: #{options[:method]}"
end
uclust.each do |record|
+++ /dev/null
-#!/bin/bash
-
-# Install script for Biopieces.
-# October 2011, Martin A. Hansen
-
-bp_code="$HOME/biopieces"
-bp_data="$HOME/BP_DATA"
- bp_log="/var/log"
- bp_tmp="/tmp"
-
-# Function that renders a given message in ASCII green.
-function echo_green
-{
- local msg=$1
-
- echo -e "\033[32;38m$msg\033[0m"
-}
-
-# Function that renders a given message in ASCII yellow.
-function echo_yellow
-{
- local msg=$1
-
- echo -e "\033[33;38m$msg\033[0m"
-}
-
-# Function that renders a given message in ASCII red.
-function echo_red
-{
- local msg=$1
-
- echo -e "\033[31;38m$msg\033[0m"
-}
-
-# Function to output an abort message and exit
-function exit_abort
-{
- echo_red "abort"
-
- exit
-}
-
-# Function to output an success message and exit
-function exit_success
-{
- echo ""
- echo_green "Congratulations - you have now installed Biopieces."
- echo ""
- echo " To list all available Biopieces try 'list_biopieces'"
- echo ""
- echo " To see the synopsis of a Biopiece try 'read_fastq'"
- echo ""
- echo " To see the full description and exampels try 'read_fastq -?'"
- echo ""
- echo " Don't forget to join the Biopieces Google Group for important"
- echo " messages, questions, discussion, and suggestions:"
- echo ""
- echo " http://groups.google.com/group/biopieces"
- echo ""
- echo " And of cause there is the introduction:"
- echo ""
- echo " http://code.google.com/p/biopieces/wiki/Introduction"
- echo ""
- echo " Happy hacking!"
- echo ""
-
- exit
-}
-
-# Function to create a directory if it doesn't exist.
-function dir_create
-{
- local dir=$1
-
- echo -n "Creating $dir: "
-
- if error=$( mkdir $dir 2>&1 ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " $error"
- exit_abort
- fi
-}
-
-# Function check if a directory is writable.
-function dir_writable
-{
- local dir=$1
- local file="$dir/bp_writable"
-
- echo -n "Writable? $dir: "
-
- if error=$( touch $file 2>&1 ); then
- echo_green "OK"
- rm $file
- else
- echo_red "FAIL"
- echo " $error"
- exit_abort
- fi
-}
-
-# Function to prompt for continuation of installation.
-function prompt_install
-{
- echo ""
- echo "Welcome to the Biopieces installer."
- echo ""
- echo " This installer is experimental, and is being evaluated to replace"
- echo " the previous, tedious way:"
- echo ""
- echo " http://code.google.com/p/biopieces/wiki/Installation"
- echo ""
- echo " The installer will now do the following:"
- echo ""
- echo " * Check for existing Biopieces installation."
- echo " * Check prerequisites:"
- echo " - Subversion client"
- echo " - Perl"
- echo " - Perl modules"
- echo " - Ruby"
- echo " - Ruby gems"
- echo " - Auxillary programs"
- echo ""
- echo " * Create installation directories."
- echo " * Download code from repository."
- echo " * Set environment in .bashrc."
- echo " * Run tests"
- echo ""
- echo " Problems? Check out the FAQ:"
- echo ""
- echo " http://code.google.com/p/biopieces/wiki/FAQ"
- echo ""
- echo " Help is available at the Biopieces Google Group:"
- echo ""
- echo " http://groups.google.com/group/biopieces"
- echo ""
- echo " Bugs & issues:"
- echo ""
- echo " http://code.google.com/p/biopieces/issues/list"
- echo ""
-
- while true; do
- read -p "Continue (yes/no)? " answer
- case $answer in
- [Yy]* ) break;;
- [Nn]* ) exit_abort;;
- esac
- done
-}
-
-# Function to prompt the checking of any existing Biopieces installation.
-function prompt_install_existing
-{
- echo "Checking for existing Biopieces installation:"
-
- if [ $BP_DIR ]; then
- echo_yellow " WARNING: \$BP_DIR is already set to: $BP_DIR"
- found=1
- fi
-
- if [ $BP_DATA ]; then
- echo_yellow " WARNING: \$BP_DATA is already set to: $BP_DATA"
- found=1
- fi
-
- if [ $BP_TMP ]; then
- echo_yellow " WARNING: \$BP_TMP is already set to: $BP_TMP"
- found=1
- fi
-
- if [ $BP_LOG ]; then
- echo_yellow " WARNING: \$BP_LOG is already set to: $BP_LOG"
- found=1
- fi
-
- if [ $found ]; then
- echo ""
- echo " An old installation of Biopeices appears to exists."
- else
- echo ""
- echo " No installation of Biopeices found."
- fi
-
- while true; do
- read -p "Continue (yes/no)? " answer
- case $answer in
- [Yy]* ) break;;
- [Nn]* ) exit_abort;;
- esac
- done
-}
-
-# Function to prompt the testing of prerequisites.
-function prompt_test_prerequisites
-{
- echo "Testing prerequisites:"
-
- test_bash
- test_svn
- test_perl
- test_perl_module "Inline"
- test_perl_module "JSON::XS"
- test_perl_module "SVG"
- test_perl_module "Bit::Vector"
- test_perl_module "Time::HiRes"
- test_ruby
- test_ruby_gem "gnuplot"
- test_ruby_gem "narray"
- test_aux_program "blastall"
- test_aux_program "blat"
- test_aux_program "bwa"
- test_aux_program "bowtie"
- test_aux_program "formatdb"
- test_aux_program "gnuplot"
- test_aux_program "idba"
- test_aux_program "muscle"
- test_aux_program "mummer"
- test_aux_program "mysql"
- test_aux_program "prodigal"
- test_aux_program "Ray"
- test_aux_program "scan_for_matches"
- test_aux_program "uclust"
- test_aux_program "velveth"
- test_aux_program "velvetg"
- test_aux_program "vmatch"
-
- echo ""
- echo " Any WARNINGs indicate that the executable for that auxillary"
- echo " program could not be found. While not critical, this will"
- echo " cause some Biopieces to FAIL."
-
- while true; do
- read -p "Continue (yes/no)? " answer
- case $answer in
- [Yy]* ) break;;
- [Nn]* ) exit_abort;;
- esac
- done
-}
-
-# Function to prompt the selection of the code directory.
-function prompt_install_dir_code
-{
- read -p "Enter directory for the Biopieces code (default: $bp_code): " answer;
-
- bp_code=${answer:-"$bp_code"}
-
- if [ ! -d "$bp_code" ]; then
- while true; do
- read -p "Create directory: $bp_code (yes/no)? " answer
- case $answer in
- [Yy]* ) dir_create $bp_code && break;;
- [Nn]* ) exit_abort;;
- esac
- done
- fi
-
- dir_writable $bp_code
-}
-
-# Function to prompt the selection of the data directory.
-function prompt_install_dir_data
-{
- read -p "Enter directory for the Biopieces data (default: $bp_data): " answer;
-
- bp_data=${answer:-"$bp_data"}
-
- if [ ! -d "$bp_data" ]; then
- while true; do
- read -p "Create directory: $bp_data (yes/no)? " answer
- case $answer in
- [Yy]* ) dir_create $bp_data && break;;
- [Nn]* ) exit_abort;;
- esac
- done
- fi
-
- dir_writable $bp_data
-}
-
-# Function to prompt the selection of the log directory.
-function prompt_install_dir_log
-{
- read -p "Enter directory for the Biopieces log file (default: $bp_log): " answer;
-
- bp_log=${answer:-"$bp_log"}
-
- if [ ! -d "$bp_log" ]; then
- while true; do
- read -p "Create directory: $bp_log (yes/no)? " answer
- case $answer in
- [Yy]* ) dir_create $bp_log && break;;
- [Nn]* ) exit_abort;;
- esac
- done
- fi
-
- dir_writable $bp_log
-}
-
-# Function to prompt the selection of the tmp directory.
-function prompt_install_dir_tmp
-{
- read -p "Enter directory for the Biopieces temporary files (default: $bp_tmp): " answer;
-
- bp_tmp=${answer:-"$bp_tmp"}
-
- if [ ! -d "$bp_tmp" ]; then
- while true; do
- read -p "Create directory: $bp_tmp (yes/no)? " answer
- case $answer in
- [Yy]* ) dir_create $bp_tmp && break;;
- [Nn]* ) exit_abort;;
- esac
- done
- fi
-
- dir_writable $bp_tmp
-}
-
-# Function to prompt the appending of a section to bashrc.
-function prompt_append_bashrc
-{
- local skip=0
- local section="
-
-# >>>>>>>>>>>>>>>>>>>>>>> Enabling Biopieces <<<<<<<<<<<<<<<<<<<<<<<
-
-export BP_DIR=\"$bp_code\"
-export BP_DATA=\"$bp_data\"
-export BP_TMP=\"$bp_tmp\"
-export BP_LOG=\"$bp_log\"
-
-source \"\$BP_DIR/bp_conf/bashrc\"
-
-# >>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<
-
-"
-
- echo ""
- echo "We need to append the below section to your .bashrc file."
-
- echo_yellow "$section"
-
- while true; do
- read -p "Append (yes/no/abort)? " answer
- case $answer in
- [Yy]* ) skip=0 && break;;
- [Nn]* ) skip=1 && break;;
- [Aa]* ) exit_abort;;
- esac
- done
-
- if [ $skip == 1 ]; then
- echo "Skipping"
- else
- if [ -f "$HOME/.bashrc" ]; then
- echo "Existing .bashrc file located: $HOME/.bashrc"
- echo -n "Creating backup: "
-
- if ! cp "$HOME/.bashrc" "$HOME/.bashrc_biopieces"; then
- echo_red "FAIL"
- abort
- else
- echo_green "OK"
- echo " Backup is $HOME/.bashrc_biopieces"
- fi
- fi
-
- echo -n "Appending $HOME/.bashrc: "
-
- if ! echo "$section" >> "$HOME/.bashrc"; then
- echo_red "FAIL"
- abort
- else
- echo_green "OK"
- fi
-
- echo -n "Sourcing $HOME/.bashrc: "
-
- if ! source "$HOME/.bashrc"; then
- echo_red "FAIL"
- abort
- else
- echo_green "OK"
- fi
-
- echo ""
- echo " \$BP_DIR is now set to: $BP_DIR"
- echo " \$BP_DATA is now set to: $BP_DATA"
- echo " \$BP_TMP is now set to: $BP_TMP"
- echo " \$BP_LOG is now set to: $BP_LOG"
- echo ""
- fi
-}
-
-# Function to test if we are running bash.
-function test_bash
-{
- echo -n " Testing if the running shell is bash: "
-
- if [ `echo $SHELL | grep "bash"` ]; then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " Biopieces requires bash shell not - $SHELL."
- exit_abort
- fi
-}
-
-# Function to test if subversion client is in $PATH.
-function test_svn
-{
- local program="svn"
-
- echo -n " Testing subversion client - \"$program\": "
-
- if command -v $program >/dev/null; then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " Subversion client $program was not found."
- exit_abort
- fi
-}
-
-# Function to test if the required version of Perl is installed.
-function test_perl
-{
- echo -n " Testing Perl version: "
-
- if error=$( perl -e 'use 5.8.0;' 2>&1 ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " $error" | sed "s/, stopped.*//"
- exit_abort
- fi
-}
-
-# Function to test if a given Perl module is installed.
-function test_perl_module
-{
- local module=$1
-
- echo -n " Testing required Perl module - \"$module\": "
-
- if ! error=$( perl -M$module -e '' 2>&1 > /dev/null ); then
- echo_red "FAIL"
- echo " Try: perl -MCPAN -e 'install $module'"
- exit_abort
- else
- echo_green "OK"
- fi
-}
-
-# Function to test if the required version of Ruby is installed.
-function test_ruby
-{
- echo -n " Testing Ruby version: "
-
- if error=$( ruby -e 'raise "Ruby version 1.9 required--this is only #{RUBY_VERSION}" if RUBY_VERSION < "1.9"' 2>&1 ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- exit_abort
- fi
-}
-
-# Function to test if a given Ruby gem is installed.
-function test_ruby_gem
-{
- local gem=$1
-
- echo -n " Testing required Ruby gem - \"$gem\": "
-
- if error=$( gem list --local | grep $gem ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " Try: gem install $gem"
- exit_abort
- fi
-}
-
-# Function to test is a given auxillary program is in $PATH.
-function test_aux_program
-{
- local program=$1
-
- echo -n " Testing auxiliary program - \"$program\": "
-
- if command -v $program >/dev/null; then
- echo_green "OK"
- else
- echo_yellow "WARNING"
- fi
-}
-
-# Function to checkout the Biopieces code from subversion.
-function checkout_code
-{
- echo -n "Downloading Biopieces code from repository (please wait): "
-
- if error=$( svn checkout http://biopieces.googlecode.com/svn/trunk/ $bp_code ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " $error"
- exit_abort
- fi
-}
-
-# Function to checkout the Biopieces wiki from subversion.
-function checkout_wiki
-{
- echo -n "Downloading Biopieces wiki from repository (please wait): "
-
- if error=$( svn checkout http://biopieces.googlecode.com/svn/wiki/ "$bp_code/bp_usage" ); then
- echo_green "OK"
- else
- echo_red "FAIL"
- echo " $error"
- exit_abort
- fi
-}
-
-# Function to run the Biopieces tests.
-function prompt_test_biopieces
-{
- echo "Running the Biopieces test suite:"
- echo ""
-
- "$BP_DIR/bp_test/test_all"
-
- echo ""
- echo " Any FAIL indicates broken Biopieces. This is probably because of"
- echo " missing prerequisites (see WARNINGs). You can verify this later by"
- echo " inspecting the documentation for those Biopieces. Otherwise - seek help!"
-
- while true; do
- read -p "Continue (yes/no)? " answer
- case $answer in
- [Yy]* ) break;;
- [Nn]* ) exit_abort;;
- esac
- done
-}
-
-prompt_install
-prompt_install_existing
-prompt_test_prerequisites
-prompt_install_dir_code
-prompt_install_dir_data
-prompt_install_dir_log
-prompt_install_dir_tmp
-
-checkout_code
-checkout_wiki
-
-prompt_append_bashrc
-prompt_test_biopieces
-
-exit_success
-
--- /dev/null
+#!/bin/bash
+
+# Install script for Biopieces.
+# October 2011, Martin A. Hansen
+
+bp_code="$HOME/biopieces"
+bp_data="$HOME/BP_DATA"
+ bp_log="/var/log"
+ bp_tmp="/tmp"
+
+# Function that renders a given message in ASCII green.
+function echo_green
+{
+ local msg=$1
+
+ echo -e "\033[32;38m$msg\033[0m"
+}
+
+# Function that renders a given message in ASCII yellow.
+function echo_yellow
+{
+ local msg=$1
+
+ echo -e "\033[33;38m$msg\033[0m"
+}
+
+# Function that renders a given message in ASCII red.
+function echo_red
+{
+ local msg=$1
+
+ echo -e "\033[31;38m$msg\033[0m"
+}
+
+# Function to output an abort message and exit
+function exit_abort
+{
+ echo_red "abort"
+
+ exit
+}
+
+# Function to output an success message and exit
+function exit_success
+{
+ echo ""
+ echo_green "Congratulations - you have now installed Biopieces."
+ echo ""
+ echo " To list all available Biopieces try 'list_biopieces'"
+ echo ""
+ echo " To see the synopsis of a Biopiece try 'read_fastq'"
+ echo ""
+ echo " To see the full description and exampels try 'read_fastq -?'"
+ echo ""
+ echo " Don't forget to join the Biopieces Google Group for important"
+ echo " messages, questions, discussion, and suggestions:"
+ echo ""
+ echo " http://groups.google.com/group/biopieces"
+ echo ""
+ echo " And of cause there is the introduction:"
+ echo ""
+ echo " http://code.google.com/p/biopieces/wiki/Introduction"
+ echo ""
+ echo " Happy hacking!"
+ echo ""
+
+ exit
+}
+
+# Function to create a directory if it doesn't exist.
+function dir_create
+{
+ local dir=$1
+
+ echo -n "Creating $dir: "
+
+ if error=$( mkdir $dir 2>&1 ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " $error"
+ exit_abort
+ fi
+}
+
+# Function check if a directory is writable.
+function dir_writable
+{
+ local dir=$1
+ local file="$dir/bp_writable"
+
+ echo -n "Writable? $dir: "
+
+ if error=$( touch $file 2>&1 ); then
+ echo_green "OK"
+ rm $file
+ else
+ echo_red "FAIL"
+ echo " $error"
+ exit_abort
+ fi
+}
+
+# Function to prompt for continuation of installation.
+function prompt_install
+{
+ echo ""
+ echo "Welcome to the Biopieces installer."
+ echo ""
+ echo " This installer is experimental, and is being evaluated to replace"
+ echo " the previous, tedious way:"
+ echo ""
+ echo " http://code.google.com/p/biopieces/wiki/Installation"
+ echo ""
+ echo " The installer will now do the following:"
+ echo ""
+ echo " * Check for existing Biopieces installation."
+ echo " * Check prerequisites:"
+ echo " - Subversion client"
+ echo " - Perl"
+ echo " - Perl modules"
+ echo " - Ruby"
+ echo " - Ruby gems"
+ echo " - Auxillary programs"
+ echo ""
+ echo " * Create installation directories."
+ echo " * Download code from repository."
+ echo " * Set environment in .bashrc."
+ echo " * Run tests"
+ echo ""
+ echo " Problems? Check out the FAQ:"
+ echo ""
+ echo " http://code.google.com/p/biopieces/wiki/FAQ"
+ echo ""
+ echo " Help is available at the Biopieces Google Group:"
+ echo ""
+ echo " http://groups.google.com/group/biopieces"
+ echo ""
+ echo " Bugs & issues:"
+ echo ""
+ echo " http://code.google.com/p/biopieces/issues/list"
+ echo ""
+
+ while true; do
+ read -p "Continue (yes/no)? " answer
+ case $answer in
+ [Yy]* ) break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+}
+
+# Function to prompt the checking of any existing Biopieces installation.
+function prompt_install_existing
+{
+ echo "Checking for existing Biopieces installation:"
+
+ if [ $BP_DIR ]; then
+ echo_yellow " WARNING: \$BP_DIR is already set to: $BP_DIR"
+ found=1
+ fi
+
+ if [ $BP_DATA ]; then
+ echo_yellow " WARNING: \$BP_DATA is already set to: $BP_DATA"
+ found=1
+ fi
+
+ if [ $BP_TMP ]; then
+ echo_yellow " WARNING: \$BP_TMP is already set to: $BP_TMP"
+ found=1
+ fi
+
+ if [ $BP_LOG ]; then
+ echo_yellow " WARNING: \$BP_LOG is already set to: $BP_LOG"
+ found=1
+ fi
+
+ if [ $found ]; then
+ echo ""
+ echo " An old installation of Biopeices appears to exists."
+ else
+ echo ""
+ echo " No installation of Biopeices found."
+ fi
+
+ while true; do
+ read -p "Continue (yes/no)? " answer
+ case $answer in
+ [Yy]* ) break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+}
+
+# Function to prompt the testing of prerequisites.
+function prompt_test_prerequisites
+{
+ echo "Testing prerequisites:"
+
+ test_bash
+ test_svn
+ test_perl
+ test_perl_module "Inline"
+ test_perl_module "JSON::XS"
+ test_perl_module "SVG"
+ test_perl_module "Bit::Vector"
+ test_perl_module "Time::HiRes"
+ test_ruby
+ test_ruby_gem "gnuplot"
+ test_ruby_gem "narray"
+ test_ruby_gem "RubyInline"
+ test_aux_program "blastall"
+ test_aux_program "blat"
+ test_aux_program "bwa"
+ test_aux_program "bowtie"
+ test_aux_program "formatdb"
+ test_aux_program "gnuplot"
+ test_aux_program "idba"
+ test_aux_program "muscle"
+ test_aux_program "mummer"
+ test_aux_program "mysql"
+ test_aux_program "prodigal"
+ test_aux_program "Ray"
+ test_aux_program "scan_for_matches"
+ test_aux_program "usearch"
+ test_aux_program "velveth"
+ test_aux_program "velvetg"
+ test_aux_program "vmatch"
+
+ echo ""
+ echo " Any WARNINGs indicate that the executable for that auxillary"
+ echo " program could not be found. While not critical, this will"
+ echo " cause some Biopieces to FAIL."
+
+ while true; do
+ read -p "Continue (yes/no)? " answer
+ case $answer in
+ [Yy]* ) break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+}
+
+# Function to prompt the selection of the code directory.
+function prompt_install_dir_code
+{
+ read -p "Enter directory for the Biopieces code (default: $bp_code): " answer;
+
+ bp_code=${answer:-"$bp_code"}
+
+ if [ ! -d "$bp_code" ]; then
+ while true; do
+ read -p "Create directory: $bp_code (yes/no)? " answer
+ case $answer in
+ [Yy]* ) dir_create $bp_code && break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+ fi
+
+ dir_writable $bp_code
+}
+
+# Function to prompt the selection of the data directory.
+function prompt_install_dir_data
+{
+ read -p "Enter directory for the Biopieces data (default: $bp_data): " answer;
+
+ bp_data=${answer:-"$bp_data"}
+
+ if [ ! -d "$bp_data" ]; then
+ while true; do
+ read -p "Create directory: $bp_data (yes/no)? " answer
+ case $answer in
+ [Yy]* ) dir_create $bp_data && break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+ fi
+
+ dir_writable $bp_data
+}
+
+# Function to prompt the selection of the log directory.
+function prompt_install_dir_log
+{
+ read -p "Enter directory for the Biopieces log file (default: $bp_log): " answer;
+
+ bp_log=${answer:-"$bp_log"}
+
+ if [ ! -d "$bp_log" ]; then
+ while true; do
+ read -p "Create directory: $bp_log (yes/no)? " answer
+ case $answer in
+ [Yy]* ) dir_create $bp_log && break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+ fi
+
+ dir_writable $bp_log
+}
+
+# Function to prompt the selection of the tmp directory.
+function prompt_install_dir_tmp
+{
+ read -p "Enter directory for the Biopieces temporary files (default: $bp_tmp): " answer;
+
+ bp_tmp=${answer:-"$bp_tmp"}
+
+ if [ ! -d "$bp_tmp" ]; then
+ while true; do
+ read -p "Create directory: $bp_tmp (yes/no)? " answer
+ case $answer in
+ [Yy]* ) dir_create $bp_tmp && break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+ fi
+
+ dir_writable $bp_tmp
+}
+
+# Function to prompt the appending of a section to bashrc.
+function prompt_append_bashrc
+{
+ local skip=0
+ local section="
+
+# >>>>>>>>>>>>>>>>>>>>>>> Enabling Biopieces <<<<<<<<<<<<<<<<<<<<<<<
+
+export BP_DIR=\"$bp_code\"
+export BP_DATA=\"$bp_data\"
+export BP_TMP=\"$bp_tmp\"
+export BP_LOG=\"$bp_log\"
+
+source \"\$BP_DIR/bp_conf/bashrc\"
+
+# >>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<
+
+"
+
+ echo ""
+ echo "We need to append the below section to your .bashrc file."
+
+ echo_yellow "$section"
+
+ while true; do
+ read -p "Append (yes/no/abort)? " answer
+ case $answer in
+ [Yy]* ) skip=0 && break;;
+ [Nn]* ) skip=1 && break;;
+ [Aa]* ) exit_abort;;
+ esac
+ done
+
+ if [ $skip == 1 ]; then
+ echo "Skipping"
+ else
+ if [ -f "$HOME/.bashrc" ]; then
+ echo "Existing .bashrc file located: $HOME/.bashrc"
+ echo -n "Creating backup: "
+
+ if ! cp "$HOME/.bashrc" "$HOME/.bashrc_biopieces"; then
+ echo_red "FAIL"
+ abort
+ else
+ echo_green "OK"
+ echo " Backup is $HOME/.bashrc_biopieces"
+ fi
+ fi
+
+ echo -n "Appending $HOME/.bashrc: "
+
+ if ! echo "$section" >> "$HOME/.bashrc"; then
+ echo_red "FAIL"
+ abort
+ else
+ echo_green "OK"
+ fi
+
+ echo -n "Sourcing $HOME/.bashrc: "
+
+ if ! source "$HOME/.bashrc"; then
+ echo_red "FAIL"
+ abort
+ else
+ echo_green "OK"
+ fi
+
+ echo ""
+ echo " \$BP_DIR is now set to: $BP_DIR"
+ echo " \$BP_DATA is now set to: $BP_DATA"
+ echo " \$BP_TMP is now set to: $BP_TMP"
+ echo " \$BP_LOG is now set to: $BP_LOG"
+ echo ""
+ fi
+}
+
+# Function to test if we are running bash.
+function test_bash
+{
+ echo -n " Testing if the running shell is bash: "
+
+ if [ `echo $SHELL | grep "bash"` ]; then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " Biopieces requires bash shell not - $SHELL."
+ exit_abort
+ fi
+}
+
+# Function to test if subversion client is in $PATH.
+function test_svn
+{
+ local program="svn"
+
+ echo -n " Testing subversion client - \"$program\": "
+
+ if command -v $program >/dev/null; then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " Subversion client $program was not found."
+ exit_abort
+ fi
+}
+
+# Function to test if the required version of Perl is installed.
+function test_perl
+{
+ echo -n " Testing Perl version: "
+
+ if error=$( perl -e 'use 5.8.0;' 2>&1 ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " $error" | sed "s/, stopped.*//"
+ exit_abort
+ fi
+}
+
+# Function to test if a given Perl module is installed.
+function test_perl_module
+{
+ local module=$1
+
+ echo -n " Testing required Perl module - \"$module\": "
+
+ if ! error=$( perl -M$module -e '' 2>&1 > /dev/null ); then
+ echo_red "FAIL"
+ echo " Try: perl -MCPAN -e 'install $module'"
+ exit_abort
+ else
+ echo_green "OK"
+ fi
+}
+
+# Function to test if the required version of Ruby is installed.
+function test_ruby
+{
+ echo -n " Testing Ruby version: "
+
+ if error=$( ruby -e 'raise "Ruby version 1.9 required--this is only #{RUBY_VERSION}" if RUBY_VERSION < "1.9"' 2>&1 ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ exit_abort
+ fi
+}
+
+# Function to test if a given Ruby gem is installed.
+function test_ruby_gem
+{
+ local gem=$1
+
+ echo -n " Testing required Ruby gem - \"$gem\": "
+
+ if error=$( gem list --local | grep $gem ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " Try: gem install $gem"
+ exit_abort
+ fi
+}
+
+# Function to test is a given auxillary program is in $PATH.
+function test_aux_program
+{
+ local program=$1
+
+ echo -n " Testing auxiliary program - \"$program\": "
+
+ if command -v $program >/dev/null; then
+ echo_green "OK"
+ else
+ echo_yellow "WARNING"
+ fi
+}
+
+# Function to checkout the Biopieces code from subversion.
+function checkout_code
+{
+ echo -n "Downloading Biopieces code from repository (please wait): "
+
+ if error=$( svn checkout http://biopieces.googlecode.com/svn/trunk/ $bp_code ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " $error"
+ exit_abort
+ fi
+}
+
+# Function to checkout the Biopieces wiki from subversion.
+function checkout_wiki
+{
+ echo -n "Downloading Biopieces wiki from repository (please wait): "
+
+ if error=$( svn checkout http://biopieces.googlecode.com/svn/wiki/ "$bp_code/bp_usage" ); then
+ echo_green "OK"
+ else
+ echo_red "FAIL"
+ echo " $error"
+ exit_abort
+ fi
+}
+
+# Function to run the Biopieces tests.
+function prompt_test_biopieces
+{
+ echo "Running the Biopieces test suite:"
+ echo ""
+
+ "$BP_DIR/bp_test/test_all"
+
+ echo ""
+ echo " Any FAIL indicates broken Biopieces. This is probably because of"
+ echo " missing prerequisites (see WARNINGs). You can verify this later by"
+ echo " inspecting the documentation for those Biopieces. Otherwise - seek help!"
+
+ while true; do
+ read -p "Continue (yes/no)? " answer
+ case $answer in
+ [Yy]* ) break;;
+ [Nn]* ) exit_abort;;
+ esac
+ done
+}
+
+prompt_install
+prompt_install_existing
+prompt_test_prerequisites
+prompt_install_dir_code
+prompt_install_dir_data
+prompt_install_dir_log
+prompt_install_dir_tmp
+
+checkout_code
+checkout_wiki
+
+prompt_append_bashrc
+prompt_test_biopieces
+
+exit_success
+
test_ruby
test_ruby_gem "gnuplot"
test_ruby_gem "narray"
+test_ruby_gem "RubyInline"
test_aux_program "blastall"
test_aux_program "blat"
test_aux_program "bwa"
test_aux_program "prodigal"
test_aux_program "Ray"
test_aux_program "scan_for_matches"
-test_aux_program "uclust"
+test_aux_program "usearch"
test_aux_program "velveth"
test_aux_program "velvetg"
test_aux_program "vmatch"
# matches are returned in an Array of Match objects.
def patscan(pattern, offset = 0, max_mismatches = 0, max_insertions = 0, max_deletions = 0)
raise BackTrackError, "Bad pattern: #{pattern}" unless pattern.downcase =~ OK_PATTERN
- raise BackTrackError, "offset: #{offset} out of range (0 ... #{self.length - 1})" unless (0 ... self.length).include? offset
+ raise BackTrackError, "offset: #{offset} out of range (0 ... #{self.length - 1})" unless (0 ... self.length).include? offset
raise BackTrackError, "max_mismatches: #{max_mismatches} out of range (0 .. #{MAX_MIS})" unless (0 .. MAX_MIS).include? max_mismatches
raise BackTrackError, "max_insertions: #{max_insertions} out of range (0 .. #{MAX_INS})" unless (0 .. MAX_INS).include? max_insertions
raise BackTrackError, "max_deletions: #{max_deletions} out of range (0 .. #{MAX_DEL})" unless (0 .. MAX_DEL).include? max_deletions
inline do |builder|
builder.add_static "id_seq", 'rb_intern("@seq")', "ID"
+ # Macro for matching nucleotides including ambiguity codes.
builder.prefix %{
#define MATCH(A,B) ((bitmap[(unsigned short) A] & bitmap[(unsigned short) B]) != 0)
}
+ # Bitmap for matching nucleotides including ambiguity codes.
+ # For each value bits are set from the left: bit pos 1 for A,
+ # bit pos 2 for T, bit pos 3 for C, and bit pos 4 for G.
builder.prefix %{
unsigned short bitmap[256] = {
0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
};
}
- # ss is the start of the string, used only for reporting the match endpoints.
+ # Backtrack algorithm for matching a pattern (p) starting in a sequence (s) allowing for mm
+ # mismatches, ins insertions and del deletions. ss is the start of the sequence, used only for
+ # reporting the match endpoints.
builder.prefix %{
unsigned int backtrack(char* ss, char* s, char* p, int mm, int ins, int del)
{
}
}
- # Find all occurrences of p starting at pos in s, with at most
- # mm mismatches, ins insertions and del deletions.
+ # Find pattern (p) in a sequence (@seq) starting at pos, with at most mm mismatches, ins
+ # insertions and del deletions.
builder.c %{
static VALUE track(char* p, unsigned int pos, int mm, int ins, int del)
{
}
end
+ # Class containing match information.
class Match
attr_reader :pos, :length, :match
require 'maasha/patternmatcher'
require 'maasha/bits'
-#require 'maasha/backtrack'
+require 'maasha/backtrack'
require 'maasha/digest'
#require 'maasha/patscan'
class Seq
#include Patscan
include PatternMatcher
-# include BackTrack
+ include BackTrack
include Digest
attr_accessor :seq_name, :seq, :type, :qual
require 'test/unit'
require 'maasha/seq'
-require 'stringio'
-require 'pp'
class BackTrackTest < Test::Unit::TestCase
def setup
- @seq = Seq.new("test", "tacgatgctagcatgcacg")
+ # 0 1
+ # 01234567890123456789
+ @seq = Seq.new("test", "tacgatgctagcatgcacgg")
end
def test_BackTrack_patscan_with_bad_pattern_raises
end
def test_BackTrack_patscan_with_OK_pattern_dont_raise
- ["N"].each { |pattern|
+ ["N", "atcg"].each { |pattern|
assert_nothing_raised { @seq.patscan(pattern) }
}
end
def test_BackTrack_patscan_with_bad_pos_raises
+ [-1, 20].each { |pos|
+ assert_raise(BackTrackError) { @seq.patscan("N", pos) }
+ }
end
def test_BackTrack_patscan_with_OK_pos_dont_raise
+ [0, 19].each { |pos|
+ assert_nothing_raised { @seq.patscan("N", pos) }
+ }
end
def test_BackTrack_patscan_with_bad_mis_raises
+ [-1, 6].each { |mis|
+ assert_raise(BackTrackError) { @seq.patscan("N", 0, mis) }
+ }
end
def test_BackTrack_patscan_with_OK_mis_dont_raise
+ [0, 5].each { |mis|
+ assert_nothing_raised { @seq.patscan("N", 0, mis) }
+ }
end
def test_BackTrack_patscan_with_bad_ins_raises
+ [-1, 6].each { |ins|
+ assert_raise(BackTrackError) { @seq.patscan("N", 0, 0, ins) }
+ }
end
def test_BackTrack_patscan_with_OK_ins_dont_raise
+ [0, 5].each { |ins|
+ assert_nothing_raised { @seq.patscan("N", 0, 0, ins) }
+ }
end
def test_BackTrack_patscan_with_bad_del_raises
+ [-1, 6].each { |del|
+ assert_raise(BackTrackError) { @seq.patscan("N", 0, 0, 0, del) }
+ }
end
def test_BackTrack_patscan_with_OK_del_dont_raise
+ [0, 5].each { |del|
+ assert_nothing_raised { @seq.patscan("N", 0, 0, 0, del) }
+ }
+ end
+
+ def test_BackTrack_patscan_perfect_left_is_ok
+ assert_equal("0:7:tacgatg", @seq.patscan("TACGATG").first.to_s)
+ end
+
+ def test_BackTrack_patscan_perfect_right_is_ok
+ assert_equal("13:7:tgcacgg", @seq.patscan("TGCACGG").first.to_s)
+ end
+
+ def test_BackTrack_patscan_ambiguity_is_ok
+ assert_equal("13:7:tgcacgg", @seq.patscan("TGCACNN").first.to_s)
+ end
+
+ def test_BackTrack_patscan_pos_is_ok
+ assert_equal("10:1:g", @seq.patscan("N", 10).first.to_s)
+ assert_equal("19:1:g", @seq.patscan("N", 10).last.to_s)
+ end
+
+ def test_BackTrack_patscan_mis_left_is_ok
+ assert_equal("0:7:tacgatg", @seq.patscan("Aacgatg", 0, 1).first.to_s)
+ end
+
+ def test_BackTrack_patscan_mis_right_is_ok
+ assert_equal("13:7:tgcacgg", @seq.patscan("tgcacgA", 0, 1).first.to_s)
+ end
+
+ def test_BackTrack_patscan_ins_left_is_ok
+ assert_equal("0:7:tacgatg", @seq.patscan("Atacgatg", 0, 0, 1).first.to_s)
+ end
+
+ def test_BackTrack_patscan_ins_right_is_ok
+ assert_equal("13:7:tgcacgg", @seq.patscan("tgcacggA", 0, 0, 1).first.to_s)
+ end
+
+ def test_BackTrack_patscan_del_left_is_ok
+ assert_equal("0:7:tacgatg", @seq.patscan("acgatg", 0, 0, 0, 1).first.to_s)
+ end
+
+ def test_BackTrack_patscan_del_right_is_ok
+ assert_equal("12:8:atgcacgg", @seq.patscan("tgcacgg", 0, 0, 0, 1).first.to_s)
end
- def test_BackTrack_patscan
-# assert_equal("0:4:tacg", @seq.patscan("TACG").first.to_s)
+ def test_BackTrack_patscan_ambiguity_mis_ins_del_all_ok
+ assert_equal("0:20:tacgatgctagcatgcacgg", @seq.patscan("tacatgcNagGatgcCacgg", 0, 1, 1, 1).first.to_s)
end
end
projects / biopieces.git / commitdiff