-# Copyright (C) 2007-2010 Martin A. Hansen.
+# Copyright (C) 2007-2011 Martin A. Hansen.
# This program is free software; you can redistribute it and/or
# modify it under the terms of the GNU General Public License
# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+require 'maasha/locator'
require 'maasha/seq'
require 'maasha/filesys'
require 'pp'
end
end
-
-# Error class for all exceptions to do with Genbank/EMBL/DDBJ feature table locators.
-class LocatorError < StandardError; end
-
-class Locator
- attr_accessor :locator, :seq, :subseq
-
- def initialize(locator, seq)
- @locator = locator
- @seq = seq
- @subseq = Seq.new(nil, "", "dna")
- parse_locator(locator)
- end
-
- def strand
- if @locator.match("complement")
- return "-"
- else
- return "+"
- end
- end
-
- def s_beg
- if @locator =~ /(\d+)/
- return $1.to_i - 1
- end
- end
-
- def s_end
- if @locator.reverse =~ /(\d+)/
- return $1.reverse.to_i - 1
- end
- end
-
- private
-
- # Method that uses recursion to parse a locator string from a feature
- # table and fetches the appropriate subsequence. the operators
- # join(), complement(), and order() are handled.
- # the locator string is broken into a comma separated lists, and
- # modified if the parens donnot balance. otherwise the comma separated
- # list of ranges are stripped from operators, and the subsequence are
- # fetched and handled according to the operators.
- # SNP locators are also dealt with (single positions).
- def parse_locator(locator, join = nil, comp = nil, order = nil)
- intervals = locator.split(",")
-
- unless balance_parens?(intervals.first) # locator includes a join/comp/order of several ranges
- case locator
- when /^join\((.*)\)$/
- locator = $1
- join = true
- when /^complement\((.*)\)$/
- locator = $1
- comp = true
- when /^order\((.*)\)$/
- locator = $1
- order = true
- end
-
- parse_locator(locator, join, comp, order)
- else
- intervals.each do |interval|
- case interval
- when /^join\((.*)\)$/
- locator = $1
- join = true
- parse_locator(locator, join, comp, order)
- when /^complement\((.*)\)$/
- locator = $1
- comp = true
- parse_locator(locator, join, comp, order)
- when /^order\((.*)\)$/
- locator = $1
- order = true
- parse_locator(locator, join, comp, order)
- when /^[<>]?(\d+)[^\d]+(\d+)$/
- int_beg = $1.to_i - 1
- int_end = $2.to_i - 1
-
- newseq = Seq.new(nil, @seq.seq[int_beg...int_end], "dna")
-
- unless newseq.seq.nil?
- newseq.revcomp if comp
-
- @subseq.seq << (order ? " " + newseq.seq : newseq.seq)
- end
- when /^(\d+)$/
- pos = $1.to_i - 1
-
- newseq = Seq.new(nil, @seq.seq[pos], "dna")
-
- unless newseq.seq.nil?
- newseq.revcomp if comp
-
- @subseq.seq << (order ? " " + newseq.seq : newseq.seq)
- end
- else
- $stderr.puts "WARNING: Could not match locator -> #{locator}";
- @subseq.seq << ""
- end
- end
- end
-
- return @subseq
- end
-
- def balance_parens?(locator)
- parens = 0
-
- locator.each_char do |char|
- case char
- when '(' then parens += 1
- when ')' then parens -= 1
- end
- end
-
- if parens == 0
- return true
- else
- return false
- end
- end
-end
-
-
__END__
--- /dev/null
+# Copyright (C) 2007-2011 Martin A. Hansen.
+
+# This program is free software; you can redistribute it and/or
+# modify it under the terms of the GNU General Public License
+# as published by the Free Software Foundation; either version 2
+# of the License, or (at your option) any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
+
+# http://www.gnu.org/copyleft/gpl.html
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# This software is part of the Biopieces framework (www.biopieces.org).
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+require 'maasha/seq'
+
+# Error class for all exceptions to do with Genbank/EMBL/DDBJ feature table locators.
+class LocatorError < StandardError; end
+
+# Class that handles Genbank/EMBL/DDBJ feature table locators.
+class Locator
+ attr_accessor :locator, :seq, :subseq
+
+ # Method to initialize a locator object.
+ def initialize(locator, seq)
+ @locator = locator
+ @seq = seq
+ @subseq = Seq.new(nil, "", "dna")
+ parse_locator(locator)
+ end
+
+ # Method that returns the strand (+ or - ) of the locator.
+ def strand
+ if @locator.match("complement")
+ return "-"
+ else
+ return "+"
+ end
+ end
+
+ # Method that returns the begin position of the locator (0-based).
+ def s_beg
+ if @locator =~ /(\d+)/
+ return $1.to_i - 1
+ end
+ end
+
+ # Method that returns the end position of the locator (0-based).
+ def s_end
+ if @locator.reverse =~ /(\d+)/
+ return $1.reverse.to_i - 1
+ end
+ end
+
+ private
+
+ # Method that uses recursion to parse a locator string from a feature table
+ # and fetches the appropriate subsequence. The operators join(), complement(),
+ # and order() are handled. The locator string is broken into a comma separated
+ # lists, and modified if the parens donnot balance. Otherwise the comma
+ # separated list of ranges are stripped from operators, and the subsequence
+ # are fetched and handled according to the operators. SNP locators are also
+ # dealt with (single positions).
+ def parse_locator(locator, join = nil, comp = nil, order = nil)
+ intervals = locator.split(",")
+
+ unless balance_parens?(intervals.first) # locator includes a join/comp/order of several ranges
+ case locator
+ when /^join\((.*)\)$/
+ locator = $1
+ join = true
+ when /^complement\((.*)\)$/
+ locator = $1
+ comp = true
+ when /^order\((.*)\)$/
+ locator = $1
+ order = true
+ end
+
+ parse_locator(locator, join, comp, order)
+ else
+ intervals.each do |interval|
+ case interval
+ when /^join\((.*)\)$/
+ locator = $1
+ join = true
+ parse_locator(locator, join, comp, order)
+ when /^complement\((.*)\)$/
+ locator = $1
+ comp = true
+ parse_locator(locator, join, comp, order)
+ when /^order\((.*)\)$/
+ locator = $1
+ order = true
+ parse_locator(locator, join, comp, order)
+ when /^[<>]?(\d+)[^\d]+(\d+)$/
+ int_beg = $1.to_i - 1
+ int_end = $2.to_i - 1
+
+ newseq = Seq.new(nil, @seq.seq[int_beg...int_end], "dna")
+
+ unless newseq.seq.nil?
+ newseq.revcomp if comp
+
+ @subseq.seq << (order ? " " + newseq.seq : newseq.seq)
+ end
+ when /^(\d+)$/
+ pos = $1.to_i - 1
+
+ newseq = Seq.new(nil, @seq.seq[pos], "dna")
+
+ unless newseq.seq.nil?
+ newseq.revcomp if comp
+
+ @subseq.seq << (order ? " " + newseq.seq : newseq.seq)
+ end
+ else
+ $stderr.puts "WARNING: Could not match locator -> #{locator}";
+ @subseq.seq << ""
+ end
+ end
+ end
+
+ return @subseq
+ end
+
+ # Method that checks if the parans in a locater string balances.
+ def balance_parens?(locator)
+ parens = 0
+
+ locator.each_char do |char|
+ case char
+ when '(' then parens += 1
+ when ')' then parens -= 1
+ end
+ end
+
+ if parens == 0
+ return true
+ else
+ return false
+ end
+ end
+end
+
+
+__END__
+
+++ /dev/null
-#!/usr/bin/env ruby
-$:.unshift File.join(File.dirname(__FILE__),'..','lib')
-
-# Copyright (C) 2007-2010 Martin A. Hansen.
-
-# This program is free software; you can redistribute it and/or
-# modify it under the terms of the GNU General Public License
-# as published by the Free Software Foundation; either version 2
-# of the License, or (at your option) any later version.
-
-# This program is distributed in the hope that it will be useful,
-# but WITHOUT ANY WARRANTY; without even the implied warranty of
-# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
-# GNU General Public License for more details.
-
-# You should have received a copy of the GNU General Public License
-# along with this program; if not, write to the Free Software
-# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
-
-# http://www.gnu.org/copyleft/gpl.html
-
-# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
-
-# This software is part of the Biopieces framework (www.biopieces.org).
-
-# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
-
-
-require 'maasha/genbank'
-require 'maasha/seq'
-require 'test/unit'
-require 'pp'
-
-class TestGenbank < Test::Unit::TestCase
- def setup
- @seq = Seq.new(nil, "tcatgatcaagatctaacagcagaagtacacttctattta", "dna")
- end
-
- def test_Locator_with_single_position_returns_correctly
- loc = Locator.new("10", @seq)
- assert_equal("a", loc.subseq.seq)
- end
-
- def test_Locator_with_single_interval_returns_correctly
- loc = Locator.new("5..10", @seq)
- assert_equal("gatca", loc.subseq.seq)
- end
-
- def test_Locator_with_multiple_intervals_return_correctly
- loc = Locator.new("5..10,15..20", @seq)
- assert_equal("gatcataaca", loc.subseq.seq)
- end
-
- def test_Locator_with_join_multiple_intervals_return_correctly
- loc = Locator.new("join(5..10,15..20)", @seq)
- assert_equal("gatcataaca", loc.subseq.seq)
- end
-
- def test_Locator_with_complement_and_single_interval_return_correctly
- loc = Locator.new("complement(5..10)", @seq)
- assert_equal("tgatc", loc.subseq.seq)
- end
-end
-
-
-__END__
--- /dev/null
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__),'..','lib')
+
+# Copyright (C) 2007-2011 Martin A. Hansen.
+
+# This program is free software; you can redistribute it and/or
+# modify it under the terms of the GNU General Public License
+# as published by the Free Software Foundation; either version 2
+# of the License, or (at your option) any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
+
+# http://www.gnu.org/copyleft/gpl.html
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# This software is part of the Biopieces framework (www.biopieces.org).
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+require 'maasha/seq'
+require 'maasha/locator'
+require 'test/unit'
+require 'pp'
+
+class TestLocator < Test::Unit::TestCase
+ def setup
+ @seq = Seq.new(nil, "tcatgatcaagatctaacagcagaagtacacttctattta", "dna")
+ end
+
+ def test_Locator_with_single_position_returns_correctly
+ loc = Locator.new("10", @seq)
+ assert_equal("a", loc.subseq.seq)
+ end
+
+ def test_Locator_with_single_interval_returns_correctly
+ loc = Locator.new("5..10", @seq)
+ assert_equal("gatca", loc.subseq.seq)
+ end
+
+ def test_Locator_with_multiple_intervals_return_correctly
+ loc = Locator.new("5..10,15..20", @seq)
+ assert_equal("gatcataaca", loc.subseq.seq)
+ end
+
+ def test_Locator_with_join_multiple_intervals_return_correctly
+ loc = Locator.new("join(5..10,15..20)", @seq)
+ assert_equal("gatcataaca", loc.subseq.seq)
+ end
+
+ def test_Locator_with_complement_and_single_interval_return_correctly
+ loc = Locator.new("complement(5..10)", @seq)
+ assert_equal("tgatc", loc.subseq.seq)
+ end
+end
+
+
+__END__
projects / biopieces.git / commitdiff