//**********************************************************************************************************************
vector<string> ShhherCommand::setParameters(){
try {
- CommandParameter pflow("flow", "InputTypes", "", "", "none", "fileflow", "none",false,false); parameters.push_back(pflow);
- CommandParameter pfile("file", "InputTypes", "", "", "none", "fileflow", "none",false,false); parameters.push_back(pfile);
- CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(plookup);
- CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "",false,false); parameters.push_back(pcutoff);
- CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
- CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "",false,false); parameters.push_back(pmaxiter);
- CommandParameter plarge("large", "Number", "", "-1", "", "", "",false,false); parameters.push_back(plarge);
- CommandParameter psigma("sigma", "Number", "", "60", "", "", "",false,false); parameters.push_back(psigma);
- CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "",false,false); parameters.push_back(pmindelta);
- CommandParameter porder("order", "String", "", "", "", "", "",false,false); parameters.push_back(porder);
- CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
- CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
+ CommandParameter pflow("flow", "InputTypes", "", "", "none", "fileflow", "none","fasta-name-group-counts-qfile",false,false,true); parameters.push_back(pflow);
+ CommandParameter pfile("file", "InputTypes", "", "", "none", "fileflow", "none","fasta-name-group-counts-qfile",false,false,true); parameters.push_back(pfile);
+ CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup);
+ CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff);
+ CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
+ CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter);
+ CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge);
+ CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma);
+ CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta);
+ CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder); CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
+ CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
vector<string> myArray;
for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
try {
string helpString = "";
helpString += "The shhh.flows command reads a file containing flowgrams and creates a file of corrected sequences.\n";
+ helpString += "The shhh.flows command parameters are flow, file, lookup, cutoff, processors, large, maxiter, sigma, mindelta and order.\n";
+ helpString += "The flow parameter is used to input your flow file.\n";
+ helpString += "The file parameter is used to input the *flow.files file created by trim.flows.\n";
+ helpString += "The lookup parameter is used specify the lookup file you would like to use. http://www.mothur.org/wiki/Lookup_files.\n";
+ helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n";
return helpString;
}
catch(exception& e) {
}
}
//**********************************************************************************************************************
+string ShhherCommand::getOutputPattern(string type) {
+ try {
+ string pattern = "";
+
+ if (type == "fasta") { pattern = "[filename],shhh.fasta"; }
+ else if (type == "name") { pattern = "[filename],shhh.names"; }
+ else if (type == "group") { pattern = "[filename],shhh.groups"; }
+ else if (type == "counts") { pattern = "[filename],shhh.counts"; }
+ else if (type == "qfile") { pattern = "[filename],shhh.qual"; }
+ else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
+
+ return pattern;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ShhherCommand", "getOutputPattern");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
ShhherCommand::ShhherCommand(){
try {
setParameters();
//initialize outputTypes
-// vector<string> tempOutNames;
-// outputTypes["pn.dist"] = tempOutNames;
+ vector<string> tempOutNames;
+ outputTypes["fasta"] = tempOutNames;
+ outputTypes["name"] = tempOutNames;
+ outputTypes["group"] = tempOutNames;
+ outputTypes["counts"] = tempOutNames;
+ outputTypes["qfile"] = tempOutNames;
}
catch(exception& e) {
}
//initialize outputTypes
- vector<string> tempOutNames;
-// outputTypes["pn.dist"] = tempOutNames;
- // outputTypes["fasta"] = tempOutNames;
+ vector<string> tempOutNames;
+ outputTypes["fasta"] = tempOutNames;
+ outputTypes["name"] = tempOutNames;
+ outputTypes["group"] = tempOutNames;
+ outputTypes["counts"] = tempOutNames;
+ outputTypes["qfile"] = tempOutNames;
+
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
else{
ofstream temp;
- string thisoutputDir = m->hasPath(flowFilesFileName); //if user entered a file with a path then preserve it
+ string thisoutputDir = outputDir;
+ if (outputDir == "") { thisoutputDir = m->hasPath(flowFilesFileName); } //if user entered a file with a path then preserve it
- //flow.files = 9 character offset
- compositeFASTAFileName = thisoutputDir + m->getRootName(m->getSimpleName(flowFilesFileName)) + "shhh.fasta";
+ //we want to rip off .files, and also .flow if its there
+ string fileroot = m->getRootName(m->getSimpleName(flowFilesFileName));
+ if (fileroot[fileroot.length()-1] == '.') { fileroot = fileroot.substr(0, fileroot.length()-1); } //rip off dot
+ string extension = m->getExtension(fileroot);
+ if (extension == ".flow") { fileroot = m->getRootName(fileroot); }
+ else { fileroot += "."; } //add back if needed
+
+ compositeFASTAFileName = thisoutputDir + fileroot + "shhh.fasta";
m->openOutputFile(compositeFASTAFileName, temp);
temp.close();
- compositeNamesFileName = thisoutputDir + m->getRootName(m->getSimpleName(flowFilesFileName)) + "shhh.names";
+ compositeNamesFileName = thisoutputDir + fileroot + "shhh.names";
m->openOutputFile(compositeNamesFileName, temp);
temp.close();
}
string temp;
temp = validParameter.validFile(parameters, "lookup", true);
if (temp == "not found") {
- lookupFileName = "LookUp_Titanium.pat";
+ string path = m->argv;
+ string tempPath = path;
+ for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
+ path = path.substr(0, (tempPath.find_last_of('m')));
+
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+ path += "lookupFiles/";
+#else
+ path += "lookupFiles\\";
+#endif
+ lookupFileName = m->getFullPathName(path) + "LookUp_Titanium.pat";
int ableToOpen;
ifstream in;
//if you can't open it, try input location
if (ableToOpen == 1) {
if (inputDir != "") { //default path is set
- string tryPath = inputDir + lookupFileName;
+ string tryPath = inputDir + m->getSimpleName(lookupFileName);
m->mothurOut("Unable to open " + lookupFileName + ". Trying input directory " + tryPath); m->mothurOutEndLine();
ifstream in2;
ableToOpen = m->openInputFile(tryPath, in2, "noerror");
for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
exepath = exepath.substr(0, (tempPath.find_last_of('m')));
- string tryPath = m->getFullPathName(exepath) + lookupFileName;
+ string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName);
m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
ifstream in2;
int ableToOpen = m->openInputFile(tryPath, in2, "noerror");
temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; }
m->mothurConvert(temp, sigma);
- flowOrder = validParameter.validFile(parameters, "order", false);
- if (flowOrder == "not found"){ flowOrder = "TACG"; }
- else if(flowOrder.length() != 4){
- m->mothurOut("The value of the order option must be four bases long\n");
- }
+ temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
+ if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
+ }
+ else {
+ if (toupper(temp[0]) == 'A') { flowOrder = "TACG"; }
+ else if(toupper(temp[0]) == 'B'){
+ flowOrder = "TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC"; }
+ else if(toupper(temp[0]) == 'I'){
+ flowOrder = "TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC"; }
+ else {
+ m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
+ }
+ }
+
}
#ifdef USE_MPI
if(compositeFASTAFileName != ""){
- outputNames.push_back(compositeFASTAFileName);
- outputNames.push_back(compositeNamesFileName);
+ outputNames.push_back(compositeFASTAFileName); outputTypes["fasta"].push_back(compositeFASTAFileName);
+ outputNames.push_back(compositeNamesFileName); outputTypes["name"].push_back(compositeNamesFileName);
}
m->mothurOutEndLine();
for(int i=0;i<numSeqs;i++){
duplicateNames[mapSeqToUnique[i]] += seqNameVector[i] + ',';
}
-
- string nameFileName = flowFileName.substr(0,flowFileName.find_last_of('.')) + ".shhh.names";
+ map<string, string> variables;
+ variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string nameFileName = getOutputFileName("name",variables);
ofstream nameFile;
m->openOutputFile(nameFileName, nameFile);
}
}
if(i % 100 == 0){
- m->mothurOut(toString(i) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
+ m->mothurOutJustToScreen(toString(i) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
}
}
if (m->control_pressed) { return fDistFileName; }
- m->mothurOut(toString(stopSeq) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
+ m->mothurOutJustToScreen(toString(stopSeq) + '\t' + toString(time(NULL) - begTime) + '\t' + toString((clock()-begClock)/CLOCKS_PER_SEC) + '\n');
ofstream distFile(fDistFileName.c_str());
distFile << outStream.str();
try{
if (numOTUs < processors) { processors = 1; }
+ if (m->debug) { m->mothurOut("[DEBUG]: numSeqs = " + toString(numSeqs) + " numOTUS = " + toString(numOTUs) + " about to alloc a dist vector with size = " + toString((numSeqs * numOTUs)) + ".\n"); }
+
dist.assign(numSeqs * numOTUs, 0);
change.assign(numOTUs, 1);
centroids.assign(numOTUs, -1);
nSeqsBreaks.assign(processors+1, 0);
nOTUsBreaks.assign(processors+1, 0);
+ if (m->debug) { m->mothurOut("[DEBUG]: made it through the memory allocation.\n"); }
+
nSeqsBreaks[0] = 0;
for(int i=0;i<processors;i++){
nSeqsBreaks[i+1] = nSeqsBreaks[i] + (int)((double) numSeqs / (double) processors);
float intensity;
- flowFile >> numFlowCells;
+ string numFlowTest;
+ flowFile >> numFlowTest;
+
+ if (!m->isContainingOnlyDigits(numFlowTest)) { m->mothurOut("[ERROR]: expected a number and got " + numFlowTest + ", quitting. Did you use the flow parameter instead of the file parameter?"); m->mothurOutEndLine(); exit(1); }
+ else { convert(numFlowTest, numFlowCells); }
+
int index = 0;//pcluster
while(!flowFile.eof()){
try {
ReadMatrix* read = new ReadColumnMatrix(distFileName);
- read->setCutoff(cutoff);
-
- NameAssignment* clusterNameMap = new NameAssignment(namesFileName);
- clusterNameMap->readMap();
- read->read(clusterNameMap);
-
- ListVector* list = read->getListVector();
- SparseMatrix* matrix = read->getMatrix();
+ read->setCutoff(cutoff);
+
+ NameAssignment* clusterNameMap = new NameAssignment(namesFileName);
+ clusterNameMap->readMap();
+ read->read(clusterNameMap);
- delete read;
- delete clusterNameMap;
+ ListVector* list = read->getListVector();
+ SparseDistanceMatrix* matrix = read->getDMatrix();
+
+ delete read;
+ delete clusterNameMap;
RAbundVector* rabund = new RAbundVector(list->getRAbundVector());
- Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest");
+ float adjust = -1.0;
+ Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest", adjust);
string tag = cluster->getTag();
double clusterCutoff = cutoff;
try {
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
- string qualityFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.qual";
+ map<string, string> variables;
+ variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string qualityFileName = getOutputFileName("qfile",variables);
ofstream qualityFile;
m->openOutputFile(qualityFileName, qualityFile);
if (m->control_pressed) { break; }
int index = 0;
- int base = 0;
if(nSeqsPerOTU[i] > 0){
- qualities[i].assign(1024, -1);
while(index < numFlowCells){
double maxPrValue = 1e8;
value = (int)floor(temp);
if(value > 100){ value = 100; }
- qualities[i][base] = (int)value;
- base++;
+ qualities[i].push_back((int)value);
}
}
if(otuCounts[i] > 0){
qualityFile << '>' << seqNameVector[mapUniqueToSeq[i]] << endl;
-
- int j=4; //need to get past the first four bases
- while(qualities[i][j] != -1){
- qualityFile << qualities[i][j] << ' ';
- j++;
- }
+ for (int j = 4; j < qualities[i].size(); j++) { qualityFile << qualities[i][j] << ' '; }
qualityFile << endl;
}
}
qualityFile.close();
- outputNames.push_back(qualityFileName);
+ outputNames.push_back(qualityFileName); outputTypes["qfile"].push_back(qualityFileName);
}
catch(exception& e) {
try {
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
- string fastaFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.fasta";
+ map<string, string> variables;
+ variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string fastaFileName = getOutputFileName("fasta",variables);
ofstream fastaFile;
m->openOutputFile(fastaFileName, fastaFile);
for(int j=0;j<numFlowCells;j++){
- char base = flowOrder[j % 4];
+ char base = flowOrder[j % flowOrder.length()];
for(int k=0;k<uniqueFlowgrams[index * numFlowCells + j];k++){
newSeq += base;
}
}
fastaFile.close();
- outputNames.push_back(fastaFileName);
+ outputNames.push_back(fastaFileName); outputTypes["fasta"].push_back(fastaFileName);
if(compositeFASTAFileName != ""){
m->appendFiles(fastaFileName, compositeFASTAFileName);
try {
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
- string nameFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.names";
+ map<string, string> variables;
+ variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string nameFileName = getOutputFileName("name",variables);
ofstream nameFile;
m->openOutputFile(nameFileName, nameFile);
}
}
nameFile.close();
- outputNames.push_back(nameFileName);
+ outputNames.push_back(nameFileName); outputTypes["name"].push_back(nameFileName);
if(compositeNamesFileName != ""){
try {
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
- string fileRoot = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
- string groupFileName = fileRoot + "shhh.groups";
+ string fileRoot = m->getRootName(m->getSimpleName(flowFileName));
+ int pos = fileRoot.find_first_of('.');
+ string fileGroup = fileRoot;
+ if (pos != string::npos) { fileGroup = fileRoot.substr(pos+1, (fileRoot.length()-1-(pos+1))); }
+ map<string, string> variables;
+ variables["[filename]"] = thisOutputDir + fileRoot;
+ string groupFileName = getOutputFileName("group",variables);
ofstream groupFile;
m->openOutputFile(groupFileName, groupFile);
for(int i=0;i<numSeqs;i++){
if (m->control_pressed) { break; }
- groupFile << seqNameVector[i] << '\t' << fileRoot << endl;
+ groupFile << seqNameVector[i] << '\t' << fileGroup << endl;
}
groupFile.close();
- outputNames.push_back(groupFileName);
+ outputNames.push_back(groupFileName); outputTypes["group"].push_back(groupFileName);
}
catch(exception& e) {
try {
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir += m->hasPath(flowFileName); }
- string otuCountsFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.counts";
+ map<string, string> variables;
+ variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string otuCountsFileName = getOutputFileName("counts",variables);
ofstream otuCountsFile;
m->openOutputFile(otuCountsFileName, otuCountsFile);
otuCountsFile << "ideal\t";
for(int j=8;j<numFlowCells;j++){
- char base = bases[j % 4];
+ char base = bases[j % bases.length()];
for(int s=0;s<uniqueFlowgrams[index * numFlowCells + j];s++){
otuCountsFile << base;
}
string newSeq = "";
for(int k=0;k<lengths[sequence];k++){
- char base = bases[k % 4];
+ char base = bases[k % bases.length()];
int freq = int(0.01 * (double)flowDataIntI[sequence * numFlowCells + k] + 0.5);
for(int s=0;s<freq;s++){
}
}
otuCountsFile.close();
- outputNames.push_back(otuCountsFileName);
+ outputNames.push_back(otuCountsFileName); outputTypes["counts"].push_back(otuCountsFileName);
}
catch(exception& e) {
int ShhherCommand::execute(){
try {
- if (abort == true) { return 0; }
+ if (abort == true) { if (calledHelp) { return 0; } return 2; }
getSingleLookUp(); if (m->control_pressed) { return 0; }
getJointLookUp(); if (m->control_pressed) { return 0; }
if (numFiles < processors) { processors = numFiles; }
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
- if (processors == 1) { driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName, 0, flowFileVector.size()); }
+ if (processors == 1) { driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName); }
else { createProcesses(flowFileVector); } //each processor processes one file
#else
- driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName, 0, flowFileVector.size());
+ driver(flowFileVector, compositeFASTAFileName, compositeNamesFileName);
#endif
if(compositeFASTAFileName != ""){
- outputNames.push_back(compositeFASTAFileName);
- outputNames.push_back(compositeNamesFileName);
+ outputNames.push_back(compositeFASTAFileName); outputTypes["fasta"].push_back(compositeFASTAFileName);
+ outputNames.push_back(compositeNamesFileName); outputTypes["name"].push_back(compositeNamesFileName);
}
m->mothurOutEndLine();
}
}
#endif
+//********************************************************************************************************************
+//sorts biggest to smallest
+inline bool compareFileSizes(string left, string right){
+
+ FILE * pFile;
+ long leftsize = 0;
+
+ //get num bytes in file
+ string filename = left;
+ pFile = fopen (filename.c_str(),"rb");
+ string error = "Error opening " + filename;
+ if (pFile==NULL) perror (error.c_str());
+ else{
+ fseek (pFile, 0, SEEK_END);
+ leftsize=ftell (pFile);
+ fclose (pFile);
+ }
+
+ FILE * pFile2;
+ long rightsize = 0;
+
+ //get num bytes in file
+ filename = right;
+ pFile2 = fopen (filename.c_str(),"rb");
+ error = "Error opening " + filename;
+ if (pFile2==NULL) perror (error.c_str());
+ else{
+ fseek (pFile2, 0, SEEK_END);
+ rightsize=ftell (pFile2);
+ fclose (pFile2);
+ }
+
+ return (leftsize > rightsize);
+}
/**************************************************************************************************/
int ShhherCommand::createProcesses(vector<string> filenames){
//sanity check
if (filenames.size() < processors) { processors = filenames.size(); }
-
+
+ //sort file names by size to divide load better
+ sort(filenames.begin(), filenames.end(), compareFileSizes);
+
+ vector < vector <string> > dividedFiles; //dividedFiles[1] = vector of filenames for process 1...
+ dividedFiles.resize(processors);
+
+ //for each file, figure out which process will complete it
+ //want to divide the load intelligently so the big files are spread between processes
+ for (int i = 0; i < filenames.size(); i++) {
+ int processToAssign = (i+1) % processors;
+ if (processToAssign == 0) { processToAssign = processors; }
+
+ dividedFiles[(processToAssign-1)].push_back(filenames[i]);
+ }
+
+ //now lets reverse the order of ever other process, so we balance big files running with little ones
+ for (int i = 0; i < processors; i++) {
+ int remainder = ((i+1) % processors);
+ if (remainder) { reverse(dividedFiles[i].begin(), dividedFiles[i].end()); }
+ }
+
+
//divide the groups between the processors
- vector<linePair> lines;
+ /*vector<linePair> lines;
+ vector<int> numFilesToComplete;
int numFilesPerProcessor = filenames.size() / processors;
for (int i = 0; i < processors; i++) {
int startIndex = i * numFilesPerProcessor;
int endIndex = (i+1) * numFilesPerProcessor;
if(i == (processors - 1)){ endIndex = filenames.size(); }
lines.push_back(linePair(startIndex, endIndex));
- }
+ numFilesToComplete.push_back((endIndex-startIndex));
+ }*/
#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
- num = driver(filenames, compositeFASTAFileName + toString(getpid()) + ".temp", compositeNamesFileName + toString(getpid()) + ".temp", lines[process].start, lines[process].end);
+ num = driver(dividedFiles[process], compositeFASTAFileName + m->mothurGetpid(process) + ".temp", compositeNamesFileName + m->mothurGetpid(process) + ".temp");
+
+ //pass numSeqs to parent
+ ofstream out;
+ string tempFile = compositeFASTAFileName + m->mothurGetpid(process) + ".num.temp";
+ m->openOutputFile(tempFile, out);
+ out << num << endl;
+ out.close();
+
exit(0);
}else {
m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
}
//do my part
- driver(filenames, compositeFASTAFileName, compositeNamesFileName, lines[0].start, lines[0].end);
+ driver(dividedFiles[0], compositeFASTAFileName, compositeNamesFileName);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
//Windows version shared memory, so be careful when passing variables through the shhhFlowsData struct.
//Above fork() will clone, so memory is separate, but that's not the case with windows,
//////////////////////////////////////////////////////////////////////////////////////////////////////
-
+ /*
vector<shhhFlowsData*> pDataArray;
DWORD dwThreadIdArray[processors-1];
HANDLE hThreadArray[processors-1];
CloseHandle(hThreadArray[i]);
delete pDataArray[i];
}
-
+ */
#endif
for (int i=0;i<processIDS.size();i++) {
+ ifstream in;
+ string tempFile = compositeFASTAFileName + toString(processIDS[i]) + ".num.temp";
+ m->openInputFile(tempFile, in);
+ if (!in.eof()) {
+ int tempNum = 0;
+ in >> tempNum;
+ if (tempNum != dividedFiles[i+1].size()) {
+ m->mothurOut("[ERROR]: main process expected " + toString(processIDS[i]) + " to complete " + toString(dividedFiles[i+1].size()) + " files, and it only reported completing " + toString(tempNum) + ". This will cause file mismatches. The flow files may be too large to process with multiple processors. \n");
+ }
+ }
+ in.close(); m->mothurRemove(tempFile);
+
if (compositeFASTAFileName != "") {
m->appendFiles((compositeFASTAFileName + toString(processIDS[i]) + ".temp"), compositeFASTAFileName);
m->appendFiles((compositeNamesFileName + toString(processIDS[i]) + ".temp"), compositeNamesFileName);
out << thisNumFLows << endl;
files.push_back(outputFileName);
+ int numLinesWrote = 0;
for (int i = 0; i < largeSize; i++) {
if (in.eof()) { break; }
- string line = m->getline(in);
+ string line = m->getline(in); m->gobble(in);
out << line << endl;
+ numLinesWrote++;
}
out.close();
+
+ if (numLinesWrote == 0) { m->mothurRemove(outputFileName); files.pop_back(); }
count++;
}
in.close();
if (m->control_pressed) { for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); } files.clear(); }
+ m->mothurOut("\nDivided " + filename + " into " + toString(files.size()) + " files.\n\n");
+
return files;
}
catch(exception& e) {
}
/**************************************************************************************************/
-int ShhherCommand::driver(vector<string> filenames, string thisCompositeFASTAFileName, string thisCompositeNamesFileName, int start, int end){
+int ShhherCommand::driver(vector<string> filenames, string thisCompositeFASTAFileName, string thisCompositeNamesFileName){
try {
- for(int i=start;i<end;i++){
+ int numCompleted = 0;
+
+ for(int i=0;i<filenames.size();i++){
if (m->control_pressed) { break; }
double begClock = clock();
unsigned long long begTime;
+ string fileNameForOutput = filenames[i];
+
for (int g = 0; g < theseFlowFileNames.size(); g++) {
string flowFileName = theseFlowFileNames[g];
vector<int> uniqueLengths;
int numFlowCells;
+ if (m->debug) { m->mothurOut("[DEBUG]: About to read flowgrams.\n"); }
int numSeqs = getFlowData(flowFileName, seqNameVector, lengths, flowDataIntI, nameMap, numFlowCells);
if (m->control_pressed) { break; }
begTime = time(NULL);
- flowDistParentFork(numFlowCells, distFileName, numUniques, mapUniqueToSeq, mapSeqToUnique, lengths, flowDataPrI, flowDataIntI);
+ flowDistParentFork(numFlowCells, distFileName, numUniques, mapUniqueToSeq, mapSeqToUnique, lengths, flowDataPrI, flowDataIntI);
m->mothurOutEndLine();
m->mothurOut("Total time: " + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/CLOCKS_PER_SEC) + '\n');
vector<int> nSeqsBreaks;
vector<int> nOTUsBreaks;
+ if (m->debug) { m->mothurOut("[DEBUG]: numSeqs = " + toString(numSeqs) + " numOTUS = " + toString(numOTUs) + " about to alloc a dist vector with size = " + toString((numSeqs * numOTUs)) + ".\n"); }
+
dist.assign(numSeqs * numOTUs, 0);
change.assign(numOTUs, 1);
centroids.assign(numOTUs, -1);
nSeqsBreaks[1] = numSeqs;
nOTUsBreaks[1] = numOTUs;
+ if (m->debug) { m->mothurOut("[DEBUG]: done allocating memory, about to denoise.\n"); }
+
if (m->control_pressed) { break; }
double maxDelta = 0;
m->mothurOut("\nFinalizing...\n");
fill(numOTUs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, aaP, aaI);
+ if (m->debug) { m->mothurOut("[DEBUG]: done fill().\n"); }
+
if (m->control_pressed) { break; }
setOTUs(numOTUs, numSeqs, seqNumber, seqIndex, cumNumSeqs, nSeqsPerOTU, otuData, singleTau, dist, aaP, aaI);
+ if (m->debug) { m->mothurOut("[DEBUG]: done setOTUs().\n"); }
+
if (m->control_pressed) { break; }
vector<int> otuCounts(numOTUs, 0);
- for(int i=0;i<numSeqs;i++) { otuCounts[otuData[i]]++; }
+ for(int j=0;j<numSeqs;j++) { otuCounts[otuData[j]]++; }
- calcCentroidsDriver(numOTUs, cumNumSeqs, nSeqsPerOTU, seqIndex, change, centroids, singleTau, mapSeqToUnique, uniqueFlowgrams, flowDataIntI, lengths, numFlowCells, seqNumber);
+ calcCentroidsDriver(numOTUs, cumNumSeqs, nSeqsPerOTU, seqIndex, change, centroids, singleTau, mapSeqToUnique, uniqueFlowgrams, flowDataIntI, lengths, numFlowCells, seqNumber);
+
+ if (m->debug) { m->mothurOut("[DEBUG]: done calcCentroidsDriver().\n"); }
if (m->control_pressed) { break; }
if ((large) && (g == 0)) { flowFileName = filenames[i]; theseFlowFileNames[0] = filenames[i]; }
string thisOutputDir = outputDir;
if (outputDir == "") { thisOutputDir = m->hasPath(flowFileName); }
- string qualityFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.qual";
- string fastaFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.fasta";
- string nameFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.names";
- string otuCountsFileName = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName)) + "shhh.counts";
- string fileRoot = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
- string groupFileName = fileRoot + "shhh.groups";
+ map<string, string> variables;
+ variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string qualityFileName = getOutputFileName("qfile",variables);
+ string fastaFileName = getOutputFileName("fasta",variables);
+ string nameFileName = getOutputFileName("name",variables);
+ string otuCountsFileName = getOutputFileName("counts",variables);
+ string fileRoot = m->getRootName(m->getSimpleName(flowFileName));
+ int pos = fileRoot.find_first_of('.');
+ string fileGroup = fileRoot;
+ if (pos != string::npos) { fileGroup = fileRoot.substr(pos+1, (fileRoot.length()-1-(pos+1))); }
+ string groupFileName = getOutputFileName("group",variables);
writeQualities(numOTUs, numFlowCells, qualityFileName, otuCounts, nSeqsPerOTU, seqNumber, singleTau, flowDataIntI, uniqueFlowgrams, cumNumSeqs, mapUniqueToSeq, seqNameVector, centroids, aaI); if (m->control_pressed) { break; }
writeSequences(thisCompositeFASTAFileName, numOTUs, numFlowCells, fastaFileName, otuCounts, uniqueFlowgrams, seqNameVector, aaI, centroids);if (m->control_pressed) { break; }
writeNames(thisCompositeNamesFileName, numOTUs, nameFileName, otuCounts, seqNameVector, aaI, nSeqsPerOTU); if (m->control_pressed) { break; }
writeClusters(otuCountsFileName, numOTUs, numFlowCells,otuCounts, centroids, uniqueFlowgrams, seqNameVector, aaI, nSeqsPerOTU, lengths, flowDataIntI); if (m->control_pressed) { break; }
- writeGroups(groupFileName, fileRoot, numSeqs, seqNameVector); if (m->control_pressed) { break; }
+ writeGroups(groupFileName, fileGroup, numSeqs, seqNameVector); if (m->control_pressed) { break; }
if (large) {
if (g > 0) {
- m->appendFiles(qualityFileName, (thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0])) + "shhh.qual"));
+ variables["[filename]"] = thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0]));
+ m->appendFiles(qualityFileName, getOutputFileName("qfile",variables));
m->mothurRemove(qualityFileName);
- m->appendFiles(fastaFileName, (thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0])) + "shhh.fasta"));
+ m->appendFiles(fastaFileName, getOutputFileName("fasta",variables));
m->mothurRemove(fastaFileName);
- m->appendFiles(nameFileName, (thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0])) + "shhh.names"));
+ m->appendFiles(nameFileName, getOutputFileName("name",variables));
m->mothurRemove(nameFileName);
- m->appendFiles(otuCountsFileName, (thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0])) + "shhh.counts"));
+ m->appendFiles(otuCountsFileName, getOutputFileName("counts",variables));
m->mothurRemove(otuCountsFileName);
- m->appendFiles(groupFileName, (thisOutputDir + m->getRootName(m->getSimpleName(theseFlowFileNames[0])) + "shhh.groups"));
+ m->appendFiles(groupFileName, getOutputFileName("group",variables));
m->mothurRemove(groupFileName);
- m->mothurRemove(theseFlowFileNames[g]);
}
+ m->mothurRemove(theseFlowFileNames[g]);
}
}
- m->mothurOut("Total time to process " + flowFileName + ":\t" + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/(double)CLOCKS_PER_SEC) + '\n');
+ numCompleted++;
+ m->mothurOut("Total time to process " + fileNameForOutput + ":\t" + toString(time(NULL) - begTime) + '\t' + toString((clock() - begClock)/(double)CLOCKS_PER_SEC) + '\n');
}
if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; }
- return 0;
+ return numCompleted;
}catch(exception& e) {
m->errorOut(e, "ShhherCommand", "driver");
thisFlowDataIntI.clear();
thisNameMap.clear();
- flowFile >> numFlowCells;
+ string numFlowTest;
+ flowFile >> numFlowTest;
+
+ if (!m->isContainingOnlyDigits(numFlowTest)) { m->mothurOut("[ERROR]: expected a number and got " + numFlowTest + ", quitting. Did you use the flow parameter instead of the file parameter?"); m->mothurOutEndLine(); exit(1); }
+ else { convert(numFlowTest, numFlowCells); }
+
+ if (m->debug) { m->mothurOut("[DEBUG]: numFlowCells = " + toString(numFlowCells) + ".\n"); }
int index = 0;//pcluster
while(!flowFile.eof()){
if (m->control_pressed) { break; }
flowFile >> seqName >> currentNumFlowCells;
+
thisLengths.push_back(currentNumFlowCells);
thisSeqNameVector.push_back(seqName);
thisNameMap[seqName] = index++;//pcluster
-
+
+ if (m->debug) { m->mothurOut("[DEBUG]: seqName = " + seqName + " length = " + toString(currentNumFlowCells) + " index = " + toString(index) + "\n"); }
+
for(int i=0;i<numFlowCells;i++){
flowFile >> intensity;
if(intensity > 9.99) { intensity = 9.99; }
}
}
if(i % 100 == 0){
- m->mothurOut(toString(i) + "\t" + toString(time(NULL) - begTime));
- m->mothurOut("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC));
- m->mothurOutEndLine();
+ m->mothurOutJustToScreen(toString(i) + "\t" + toString(time(NULL) - begTime));
+ m->mothurOutJustToScreen("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC)+"\n");
}
}
if (m->control_pressed) {}
else {
- m->mothurOut(toString(stopSeq-1) + "\t" + toString(time(NULL) - begTime));
- m->mothurOut("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC));
- m->mothurOutEndLine();
+ m->mothurOutJustToScreen(toString(stopSeq-1) + "\t" + toString(time(NULL) - begTime));
+ m->mothurOutJustToScreen("\t" + toString((clock()-begClock)/CLOCKS_PER_SEC)+"\n");
}
return 0;
read->read(clusterNameMap);
ListVector* list = read->getListVector();
- SparseMatrix* matrix = read->getMatrix();
+ SparseDistanceMatrix* matrix = read->getDMatrix();
delete read;
delete clusterNameMap;
RAbundVector* rabund = new RAbundVector(list->getRAbundVector());
- Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest");
+ float adjust = -1.0;
+ Cluster* cluster = new CompleteLinkage(rabund, list, matrix, cutoff, "furthest", adjust);
string tag = cluster->getTag();
double clusterCutoff = cutoff;
listFile >> label >> numOTUs;
+ if (m->debug) { m->mothurOut("[DEBUG]: Getting OTU Data...\n"); }
+
otuData.assign(numSeqs, 0);
cumNumSeqs.assign(numOTUs, 0);
nSeqsPerOTU.assign(numOTUs, 0);
for(int i=0;i<numOTUs;i++){
if (m->control_pressed) { break; }
+ if (m->debug) { m->mothurOut("[DEBUG]: processing OTU " + toString(i) + ".\n"); }
listFile >> singleOTU;
if (m->control_pressed) { break; }
int index = 0;
- int base = 0;
-
+
if(nSeqsPerOTU[i] > 0){
- qualities[i].assign(1024, -1);
while(index < numFlowCells){
+
double maxPrValue = 1e8;
short maxPrIndex = -1;
double count = 0.0000;
pr[s] += tauValue * singleLookUp[s * NUMBINS + intensity];
}
}
-
+
maxPrIndex = uniqueFlowgrams[centroids[i] * numFlowCells + index];
maxPrValue = pr[maxPrIndex];
for(int s=0;s<HOMOPS;s++){
norm += exp(-(pr[s] - maxPrValue));
}
-
+
for(int s=1;s<=maxPrIndex;s++){
int value = 0;
double temp = 0.0000;
value = (int)floor(temp);
if(value > 100){ value = 100; }
- qualities[i][base] = (int)value;
- base++;
+ qualities[i].push_back((int)value);
}
- }
+ }//end if
index++;
- }
- }
-
+
+ }//end while
+
+ }//end if
+
if(otuCounts[i] > 0){
qualityFile << '>' << seqNameVector[mapUniqueToSeq[i]] << endl;
-
- int j=4; //need to get past the first four bases
- while(qualities[i][j] != -1){
- qualityFile << qualities[i][j] << ' ';
- if (j > qualities[i].size()) { break; }
- j++;
- }
+ //need to get past the first four bases
+ for (int j = 4; j < qualities[i].size(); j++) { qualityFile << qualities[i][j] << ' '; }
qualityFile << endl;
}
- }
+ }//end for
qualityFile.close();
- outputNames.push_back(qualityFileName);
+ outputNames.push_back(qualityFileName); outputTypes["qfile"].push_back(qualityFileName);
}
catch(exception& e) {
for(int j=0;j<numFlowCells;j++){
- char base = flowOrder[j % 4];
+ char base = flowOrder[j % flowOrder.length()];
for(int k=0;k<uniqueFlowgrams[index * numFlowCells + j];k++){
newSeq += base;
}
}
fastaFile.close();
- outputNames.push_back(fastaFileName);
+ outputNames.push_back(fastaFileName); outputTypes["fasta"].push_back(fastaFileName);
if(thisCompositeFASTAFileName != ""){
m->appendFiles(fastaFileName, thisCompositeFASTAFileName);
}
}
nameFile.close();
- outputNames.push_back(nameFileName);
+ outputNames.push_back(nameFileName); outputTypes["name"].push_back(nameFileName);
if(thisCompositeNamesFileName != ""){
groupFile << seqNameVector[i] << '\t' << fileRoot << endl;
}
groupFile.close();
- outputNames.push_back(groupFileName);
+ outputNames.push_back(groupFileName); outputTypes["group"].push_back(groupFileName);
}
catch(exception& e) {
otuCountsFile << "ideal\t";
for(int j=8;j<numFlowCells;j++){
- char base = bases[j % 4];
+ char base = bases[j % bases.length()];
for(int s=0;s<uniqueFlowgrams[index * numFlowCells + j];s++){
otuCountsFile << base;
}
string newSeq = "";
for(int k=0;k<lengths[sequence];k++){
- char base = bases[k % 4];
+ char base = bases[k % bases.length()];
int freq = int(0.01 * (double)flowDataIntI[sequence * numFlowCells + k] + 0.5);
for(int s=0;s<freq;s++){
//otuCountsFile << base;
}
}
- otuCountsFile << newSeq.substr(4) << endl;
+
+ if (newSeq.length() >= 4) { otuCountsFile << newSeq.substr(4) << endl; }
+ else { otuCountsFile << "NNNN" << endl; }
}
otuCountsFile << endl;
}
}
otuCountsFile.close();
- outputNames.push_back(otuCountsFileName);
+ outputNames.push_back(otuCountsFileName); outputTypes["counts"].push_back(otuCountsFileName);
}
catch(exception& e) {