2 // sffmultiplecommand.cpp
5 // Created by Sarah Westcott on 8/14/12.
6 // Copyright (c) 2012 Schloss Lab. All rights reserved.
9 #include "sffmultiplecommand.h"
13 //**********************************************************************************************************************
14 vector<string> SffMultipleCommand::setParameters(){
16 CommandParameter pfile("file", "InputTypes", "", "", "none", "none", "none","fasta-name",false,true,true); parameters.push_back(pfile);
19 CommandParameter ptrim("trim", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(ptrim);
22 CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop);
23 CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows);
24 CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows);
25 CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(ppdiffs);
26 CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(pbdiffs);
27 CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pldiffs);
28 CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(psdiffs);
29 CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(ptdiffs);
30 CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal);
31 CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise);
32 CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder);
34 CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup);
35 CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff);
36 CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter);
37 CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge);
38 CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma);
39 CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta);
41 //trim.seqs parameters
42 CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles);
43 CommandParameter pflip("flip", "Boolean", "", "F", "", "", "","",false,false,true); parameters.push_back(pflip);
44 CommandParameter pmaxambig("maxambig", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(pmaxambig);
45 CommandParameter pminlength("minlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pminlength);
46 CommandParameter pmaxlength("maxlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pmaxlength);
47 CommandParameter pkeepforward("keepforward", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pkeepforward);
48 CommandParameter pkeepfirst("keepfirst", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pkeepfirst);
49 CommandParameter premovelast("removelast", "Number", "", "0", "", "", "","",false,false); parameters.push_back(premovelast);
52 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors);
53 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
54 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
56 vector<string> myArray;
57 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
61 m->errorOut(e, "SffMultipleCommand", "setParameters");
65 //**********************************************************************************************************************
66 string SffMultipleCommand::getHelpString(){
68 string helpString = "";
69 helpString += "The sff.multiple command reads a file containing sff filenames and optional oligos filenames. It runs the files through sffinfo, trim.flows, shhh.flows and trim.seqs combining the results.\n";
70 helpString += "The sff.multiple command parameters are: ";
71 vector<string> parameters = setParameters();
72 for (int i = 0; i < parameters.size()-1; i++) {
73 helpString += parameters[i] + ", ";
75 helpString += parameters[parameters.size()-1] + ".\n";
76 helpString += "The file parameter allows you to enter the a file containing the list of sff files and optional oligos files.\n";
77 helpString += "The trim parameter allows you to indicate if you would like a sequences and quality scores generated by sffinfo trimmed to the clipQualLeft and clipQualRight values. Default=True. \n";
78 helpString += "The maxambig parameter allows you to set the maximum number of ambigious bases allowed. The default is -1.\n";
79 helpString += "The maxhomop parameter allows you to set a maximum homopolymer length. \n";
80 helpString += "The minlength parameter allows you to set and minimum sequence length. \n";
81 helpString += "The maxlength parameter allows you to set and maximum sequence length. \n";
82 helpString += "The tdiffs parameter is used to specify the total number of differences allowed in the sequence. The default is pdiffs + bdiffs + sdiffs + ldiffs.\n";
83 helpString += "The bdiffs parameter is used to specify the number of differences allowed in the barcode. The default is 0.\n";
84 helpString += "The pdiffs parameter is used to specify the number of differences allowed in the primer. The default is 0.\n";
85 helpString += "The ldiffs parameter is used to specify the number of differences allowed in the linker. The default is 0.\n";
86 helpString += "The sdiffs parameter is used to specify the number of differences allowed in the spacer. The default is 0.\n";
87 helpString += "The allfiles parameter will create separate group and fasta file for each grouping. The default is F.\n";
88 helpString += "The keepforward parameter allows you to indicate whether you want the forward primer removed or not. The default is F, meaning remove the forward primer.\n";
89 helpString += "The keepfirst parameter trims the sequence to the first keepfirst number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements. \n";
90 helpString += "The removelast removes the last removelast number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements.\n";
91 helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n";
92 helpString += "Example sff.multiple(file=mySffOligosFile.txt, trim=F).\n";
93 helpString += "Note: No spaces between parameter labels (i.e. file), '=' and parameters (i.e.mySffOligosFile.txt).\n";
97 m->errorOut(e, "SffMultipleCommand", "getHelpString");
101 //**********************************************************************************************************************
102 string SffMultipleCommand::getOutputPattern(string type) {
106 if (type == "fasta") { pattern = "[filename],fasta"; }
107 else if (type == "name") { pattern = "[filename],names"; }
108 else if (type == "group") { pattern = "[filename],groups"; }
109 else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; }
113 catch(exception& e) {
114 m->errorOut(e, "SffMultipleCommand", "getOutputPattern");
118 //**********************************************************************************************************************
119 SffMultipleCommand::SffMultipleCommand(){
121 abort = true; calledHelp = true;
123 vector<string> tempOutNames;
124 outputTypes["fasta"] = tempOutNames;
125 outputTypes["name"] = tempOutNames;
126 outputTypes["group"] = tempOutNames;
128 catch(exception& e) {
129 m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
133 //**********************************************************************************************************************
135 SffMultipleCommand::SffMultipleCommand(string option) {
137 abort = false; calledHelp = false; append=false; makeGroup=false;
139 //allow user to run help
140 if(option == "help") { help(); abort = true; calledHelp = true; }
141 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
144 //valid paramters for this command
145 vector<string> myArray = setParameters();
147 OptionParser parser(option);
148 map<string, string> parameters = parser.getParameters();
150 ValidParameters validParameter;
151 map<string,string>::iterator it;
153 //check to make sure all parameters are valid for command
154 for (it = parameters.begin(); it != parameters.end(); it++) {
155 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
158 //initialize outputTypes
159 vector<string> tempOutNames;
160 outputTypes["fasta"] = tempOutNames;
161 outputTypes["name"] = tempOutNames;
162 outputTypes["group"] = tempOutNames;
165 //if the user changes the output directory command factory will send this info to us in the output parameter
166 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
168 //if the user changes the input directory command factory will send this info to us in the output parameter
169 string inputDir = validParameter.validFile(parameters, "inputdir", false);
170 if (inputDir == "not found"){ inputDir = ""; }
173 it = parameters.find("file");
174 //user has given a template file
175 if(it != parameters.end()){
176 path = m->hasPath(it->second);
177 //if the user has not given a path then, add inputdir. else leave path alone.
178 if (path == "") { parameters["file"] = inputDir + it->second; }
181 it = parameters.find("lookup");
182 //user has given a template file
183 if(it != parameters.end()){
184 path = m->hasPath(it->second);
185 //if the user has not given a path then, add inputdir. else leave path alone.
186 if (path == "") { parameters["lookup"] = inputDir + it->second; }
190 filename = validParameter.validFile(parameters, "file", true);
191 if (filename == "not open") { filename = ""; abort = true; }
192 else if (filename == "not found") { filename = ""; }
195 temp = validParameter.validFile(parameters, "trim", false); if (temp == "not found"){ temp = "T"; }
196 trim = m->isTrue(temp);
198 temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; }
199 m->mothurConvert(temp, minFlows);
201 temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; }
202 m->mothurConvert(temp, maxFlows);
204 temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; }
205 m->mothurConvert(temp, maxHomoP);
207 temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; }
208 m->mothurConvert(temp, signal);
210 temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; }
211 m->mothurConvert(temp, noise);
213 temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; }
214 m->mothurConvert(temp, bdiffs);
216 temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; }
217 m->mothurConvert(temp, pdiffs);
219 temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; }
220 m->mothurConvert(temp, ldiffs);
222 temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; }
223 m->mothurConvert(temp, sdiffs);
225 temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); }
226 m->mothurConvert(temp, tdiffs);
228 if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; }
231 temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
232 m->setProcessors(temp);
233 m->mothurConvert(temp, processors);
235 temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; }
236 if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
239 if (toupper(temp[0]) == 'A') { flowOrder = "TACG"; }
240 else if(toupper(temp[0]) == 'B'){
241 flowOrder = "TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC"; }
242 else if(toupper(temp[0]) == 'I'){
243 flowOrder = "TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC"; }
245 m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true;
250 temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; }
251 m->mothurConvert(temp, cutoff);
253 temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; }
256 temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; }
257 m->mothurConvert(temp, maxIters);
259 temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; }
260 m->mothurConvert(temp, largeSize);
261 if (largeSize != 0) { large = true; }
262 else { large = false; }
263 if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); }
265 temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; }
266 m->mothurConvert(temp, sigma);
268 temp = validParameter.validFile(parameters, "flip", false);
269 if (temp == "not found") { flip = 0; }
270 else { flip = m->isTrue(temp); }
272 temp = validParameter.validFile(parameters, "maxambig", false); if (temp == "not found") { temp = "-1"; }
273 m->mothurConvert(temp, maxAmbig);
275 temp = validParameter.validFile(parameters, "minlength", false); if (temp == "not found") { temp = "0"; }
276 m->mothurConvert(temp, minLength);
278 temp = validParameter.validFile(parameters, "maxlength", false); if (temp == "not found") { temp = "0"; }
279 m->mothurConvert(temp, maxLength);
281 temp = validParameter.validFile(parameters, "keepfirst", false); if (temp == "not found") { temp = "0"; }
282 convert(temp, keepFirst);
284 temp = validParameter.validFile(parameters, "removelast", false); if (temp == "not found") { temp = "0"; }
285 convert(temp, removeLast);
287 temp = validParameter.validFile(parameters, "allfiles", false); if (temp == "not found") { temp = "F"; }
288 allFiles = m->isTrue(temp);
290 temp = validParameter.validFile(parameters, "keepforward", false); if (temp == "not found") { temp = "F"; }
291 keepforward = m->isTrue(temp);
293 temp = validParameter.validFile(parameters, "lookup", true);
294 if (temp == "not found") {
295 lookupFileName = "LookUp_Titanium.pat";
299 ableToOpen = m->openInputFile(lookupFileName, in, "noerror");
302 //if you can't open it, try input location
303 if (ableToOpen == 1) {
304 if (inputDir != "") { //default path is set
305 string tryPath = inputDir + lookupFileName;
306 m->mothurOut("Unable to open " + lookupFileName + ". Trying input directory " + tryPath); m->mothurOutEndLine();
308 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
310 lookupFileName = tryPath;
314 //if you can't open it, try default location
315 if (ableToOpen == 1) {
316 if (m->getDefaultPath() != "") { //default path is set
317 string tryPath = m->getDefaultPath() + m->getSimpleName(lookupFileName);
318 m->mothurOut("Unable to open " + lookupFileName + ". Trying default " + tryPath); m->mothurOutEndLine();
320 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
322 lookupFileName = tryPath;
326 //if you can't open it its not in current working directory or inputDir, try mothur excutable location
327 if (ableToOpen == 1) {
328 string exepath = m->argv;
329 string tempPath = exepath;
330 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
331 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
333 string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName);
334 m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
336 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
338 lookupFileName = tryPath;
341 if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
343 else if(temp == "not open") {
345 lookupFileName = validParameter.validFile(parameters, "lookup", false);
347 //if you can't open it its not inputDir, try mothur excutable location
348 string exepath = m->argv;
349 string tempPath = exepath;
350 for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); }
351 exepath = exepath.substr(0, (tempPath.find_last_of('m')));
353 string tryPath = m->getFullPathName(exepath) + lookupFileName;
354 m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine();
356 int ableToOpen = m->openInputFile(tryPath, in2, "noerror");
358 lookupFileName = tryPath;
360 if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; }
361 }else { lookupFileName = temp; }
364 catch(exception& e) {
365 m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand");
369 //**********************************************************************************************************************
370 int SffMultipleCommand::execute(){
372 if (abort == true) { if (calledHelp) { return 0; } return 2; }
374 vector<string> sffFiles, oligosFiles;
375 readFile(sffFiles, oligosFiles);
377 outputDir = m->hasPath(filename);
378 string fileroot = outputDir + m->getRootName(m->getSimpleName(filename));
379 map<string, string> variables;
380 variables["[filename]"] = fileroot;
381 string fasta = fileroot + getOutputFileName("fasta",variables);
382 string name = fileroot + getOutputFileName("name",variables);
383 string group = fileroot + getOutputFileName("group",variables);
385 if (m->control_pressed) { return 0; }
387 if (sffFiles.size() < processors) { processors = sffFiles.size(); }
389 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
391 //trim.flows, shhh.flows cannot handle multiple processors for windows.
392 processors = 1; m->mothurOut("This command can only use 1 processor on Windows platforms, using 1 processors.\n\n");
394 if (processors == 1) { driver(sffFiles, oligosFiles, 0, sffFiles.size(), fasta, name, group); }
395 else { createProcesses(sffFiles, oligosFiles, fasta, name, group); }
397 if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; }
400 outputNames.push_back(fasta); outputTypes["fasta"].push_back(fasta);
401 m->setFastaFile(fasta);
402 outputNames.push_back(name); outputTypes["name"].push_back(name);
403 m->setNameFile(name);
404 if (makeGroup) { outputNames.push_back(group); outputTypes["group"].push_back(group); m->setGroupFile(group); }
407 //report output filenames
408 m->mothurOutEndLine();
409 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
410 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
411 m->mothurOutEndLine();
415 catch(exception& e) {
416 m->errorOut(e, "SffMultipleCommand", "execute");
420 //**********************************************************************************************************************
421 int SffMultipleCommand::readFile(vector<string>& sffFiles, vector<string>& oligosFiles){
425 m->openInputFile(filename, in);
426 bool allBlank = true;
432 if (m->control_pressed) { break; }
436 sff = m->getFullPathName(sff);
438 //ignore file pairing
439 if(sff[0] == '#'){ while (!in.eof()) { char c = in.get(); if (c == 10 || c == 13){ break; } } m->gobble(in); }
440 else { //check for oligos file
443 // get rest of line in case there is a oligos filename
446 if (c == 10 || c == 13 || c == -1){ break; }
447 else if (c == 32 || c == 9){;} //space or tab
448 else { oligos += c; }
450 sffFiles.push_back(sff);
451 if (oligos != "") { oligos = m->getFullPathName(oligos); allBlank = false; }
452 if (oligos == "") { allFull = false; }
453 oligosFiles.push_back(oligos); //will push a blank if there is not an oligos for this sff file
459 if (allBlank || allFull) { append = true; }
460 if (allFull) { makeGroup = true; }
464 catch(exception& e) {
465 m->errorOut(e, "SffMultipleCommand", "readFile");
469 //**********************************************************************************************************************
470 //runs sffinfo, summary.seqs, trim.flows, shhh.flows, trim.seqs, summary.seqs for each sff file.
471 int SffMultipleCommand::driver(vector<string> sffFiles, vector<string> oligosFiles, int start, int end, string fasta, string name, string group){
473 m->mothurRemove(fasta); m->mothurRemove(name); m->mothurRemove(group);
475 for (int s = start; s < end; s++) {
477 string sff = sffFiles[s];
478 string oligos = oligosFiles[s];
480 m->mothurOut("\n>>>>>\tProcessing " + sff + " (file " + toString(s+1) + " of " + toString(sffFiles.size()) + ")\t<<<<<\n");
483 string inputString = "sff=" + sff + ", flow=T";
484 if (trim) { inputString += ", trim=T"; }
485 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
486 m->mothurOut("Running command: sffinfo(" + inputString + ")"); m->mothurOutEndLine();
487 m->mothurCalling = true;
489 Command* sffCommand = new SffInfoCommand(inputString);
490 sffCommand->execute();
492 if (m->control_pressed){ break; }
494 map<string, vector<string> > filenames = sffCommand->getOutputFiles();
497 m->mothurCalling = false;
498 m->mothurOutEndLine();
500 //run summary.seqs on the fasta file
501 string fastaFile = "";
502 map<string, vector<string> >::iterator it = filenames.find("fasta");
503 if (it != filenames.end()) { if ((it->second).size() != 0) { fastaFile = (it->second)[0]; } }
504 else { m->mothurOut("[ERROR]: sffinfo did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
506 inputString = "fasta=" + fastaFile + ", processors=1";
507 m->mothurOutEndLine();
508 m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine();
509 m->mothurCalling = true;
511 Command* summarySeqsCommand = new SeqSummaryCommand(inputString);
512 summarySeqsCommand->execute();
514 if (m->control_pressed){ break; }
516 map<string, vector<string> > temp = summarySeqsCommand->getOutputFiles();
517 mergeOutputFileList(filenames, temp);
519 delete summarySeqsCommand;
520 m->mothurCalling = false;
522 m->mothurOutEndLine();
524 //run trim.flows on the fasta file
525 string flowFile = "";
526 it = filenames.find("flow");
527 if (it != filenames.end()) { if ((it->second).size() != 0) { flowFile = (it->second)[0]; } }
528 else { m->mothurOut("[ERROR]: sffinfo did not create a flow file, quitting.\n"); m->control_pressed = true; break; }
530 inputString = "flow=" + flowFile;
531 if (oligos != "") { inputString += ", oligos=" + oligos; }
532 inputString += ", maxhomop=" + toString(maxHomoP) + ", maxflows=" + toString(maxFlows) + ", minflows=" + toString(minFlows);
533 inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs);
534 inputString += ", tdiffs=" + toString(tdiffs) + ", signal=" + toString(signal) + ", noise=" + toString(noise) + ", order=" + flowOrder + ", processors=1";
536 m->mothurOutEndLine();
537 m->mothurOut("Running command: trim.flows(" + inputString + ")"); m->mothurOutEndLine();
538 m->mothurCalling = true;
540 Command* trimFlowCommand = new TrimFlowsCommand(inputString);
541 trimFlowCommand->execute();
543 if (m->control_pressed){ break; }
545 temp = trimFlowCommand->getOutputFiles();
546 mergeOutputFileList(filenames, temp);
548 delete trimFlowCommand;
549 m->mothurCalling = false;
552 string fileFileName = "";
555 it = temp.find("file");
556 if (it != temp.end()) { if ((it->second).size() != 0) { fileFileName = (it->second)[0]; } }
557 else { m->mothurOut("[ERROR]: trim.flows did not create a file file, quitting.\n"); m->control_pressed = true; break; }
559 vector<string> flowFiles;
560 it = temp.find("flow");
561 if (it != temp.end()) { if ((it->second).size() != 0) { flowFiles = (it->second); } }
562 else { m->mothurOut("[ERROR]: trim.flows did not create a flow file, quitting.\n"); m->control_pressed = true; break; }
564 for (int i = 0; i < flowFiles.size(); i++) {
565 string end = flowFiles[i].substr(flowFiles[i].length()-9);
566 if (end == "trim.flow") {
567 flowFile = flowFiles[i]; i+=flowFiles.size(); //if we found the trim.flow file stop looking
572 if ((fileFileName == "") && (flowFile == "")) { m->mothurOut("[ERROR]: trim.flows did not create a file file or a trim.flow file, quitting.\n"); m->control_pressed = true; break; }
574 if (fileFileName != "") { inputString = "file=" + fileFileName; }
575 else { inputString = "flow=" + flowFile; }
577 inputString += ", lookup=" + lookupFileName + ", cutoff=" + toString(cutoff); + ", maxiters=" + toString(maxIters);
578 if (large) { inputString += ", large=" + toString(largeSize); }
579 inputString += ", sigma=" +toString(sigma);
580 inputString += ", mindelta=" + toString(minDelta);
581 inputString += ", order=" + flowOrder + ", processors=1";
584 m->mothurOutEndLine();
585 m->mothurOut("Running command: shhh.flows(" + inputString + ")"); m->mothurOutEndLine();
586 m->mothurCalling = true;
588 Command* shhhFlowCommand = new ShhherCommand(inputString);
589 shhhFlowCommand->execute();
591 if (m->control_pressed){ break; }
593 temp = shhhFlowCommand->getOutputFiles();
594 mergeOutputFileList(filenames, temp);
596 delete shhhFlowCommand;
597 m->mothurCalling = false;
599 vector<string> fastaFiles;
600 vector<string> nameFiles;
601 it = temp.find("fasta");
602 if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
603 else { m->mothurOut("[ERROR]: shhh.flows did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
605 it = temp.find("name");
606 if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
607 else { m->mothurOut("[ERROR]: shhh.flows did not create a name file, quitting.\n"); m->control_pressed = true; break; }
609 //find fasta and name files with the shortest name. This is because if there is a composite name it will be the shortest.
610 fastaFile = fastaFiles[0];
611 for (int i = 1; i < fastaFiles.size(); i++) { if (fastaFiles[i].length() < fastaFile.length()) { fastaFile = fastaFiles[i]; } }
612 string nameFile = nameFiles[0];
613 for (int i = 1; i < nameFiles.size(); i++) { if (nameFiles[i].length() < nameFile.length()) { nameFile = nameFiles[i]; } }
615 inputString = "fasta=" + fastaFile + ", name=" + nameFile;
616 if (oligos != "") { inputString += ", oligos=" + oligos; }
617 if (allFiles) { inputString += ", allfiles=t"; }
618 else { inputString += ", allfiles=f"; }
619 if (flip) { inputString += ", flip=t"; }
620 else { inputString += ", flip=f"; }
621 if (keepforward) { inputString += ", keepforward=t"; }
622 else { inputString += ", keepforward=f"; }
625 inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs);
626 inputString += ", tdiffs=" + toString(tdiffs) + ", maxambig=" + toString(maxAmbig) + ", minlength=" + toString(minLength) + ", maxlength=" + toString(maxLength);
627 if (keepFirst != 0) { inputString += ", keepfirst=" + toString(keepFirst); }
628 if (removeLast != 0) { inputString += ", removelast=" + toString(removeLast); }
629 inputString += ", processors=1";
632 m->mothurOutEndLine();
633 m->mothurOut("Running command: trim.seqs(" + inputString + ")"); m->mothurOutEndLine();
634 m->mothurCalling = true;
636 Command* trimseqsCommand = new TrimSeqsCommand(inputString);
637 trimseqsCommand->execute();
639 if (m->control_pressed){ break; }
641 temp = trimseqsCommand->getOutputFiles();
642 mergeOutputFileList(filenames, temp);
644 delete trimseqsCommand;
645 m->mothurCalling = false;
647 it = temp.find("fasta");
648 if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } }
649 else { m->mothurOut("[ERROR]: trim.seqs did not create a fasta file, quitting.\n"); m->control_pressed = true; break; }
651 for (int i = 0; i < fastaFiles.size(); i++) {
652 string end = fastaFiles[i].substr(fastaFiles[i].length()-10);
653 if (end == "trim.fasta") {
654 fastaFile = fastaFiles[i]; i+=fastaFiles.size(); //if we found the trim.fasta file stop looking
658 it = temp.find("name");
659 if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } }
660 else { m->mothurOut("[ERROR]: trim.seqs did not create a name file, quitting.\n"); m->control_pressed = true; break; }
662 for (int i = 0; i < nameFiles.size(); i++) {
663 string end = nameFiles[i].substr(nameFiles[i].length()-10);
664 if (end == "trim.names") {
665 nameFile = nameFiles[i]; i+=nameFiles.size(); //if we found the trim.names file stop looking
669 vector<string> groupFiles;
670 string groupFile = "";
672 it = temp.find("group");
673 if (it != temp.end()) { if ((it->second).size() != 0) { groupFiles = (it->second); } }
675 //find group file with the shortest name. This is because if there is a composite group file it will be the shortest.
676 groupFile = groupFiles[0];
677 for (int i = 1; i < groupFiles.size(); i++) { if (groupFiles[i].length() < groupFile.length()) { groupFile = groupFiles[i]; } }
680 inputString = "fasta=" + fastaFile + ", processors=1, name=" + nameFile;
681 m->mothurOutEndLine();
682 m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine();
683 m->mothurCalling = true;
685 summarySeqsCommand = new SeqSummaryCommand(inputString);
686 summarySeqsCommand->execute();
688 if (m->control_pressed){ break; }
690 temp = summarySeqsCommand->getOutputFiles();
691 mergeOutputFileList(filenames, temp);
693 delete summarySeqsCommand;
694 m->mothurCalling = false;
696 m->mothurOutEndLine();
697 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
700 m->appendFiles(fastaFile, fasta);
701 m->appendFiles(nameFile, name);
702 if (makeGroup) { m->appendFiles(groupFile, group); }
706 for (it = filenames.begin(); it != filenames.end(); it++) {
707 for (int i = 0; i < (it->second).size(); i++) {
708 outputNames.push_back((it->second)[i]); outputTypes[it->first].push_back((it->second)[i]);
715 catch(exception& e) {
716 m->errorOut(e, "SffMultipleCommand", "driver");
720 //**********************************************************************************************************************
721 int SffMultipleCommand::mergeOutputFileList(map<string, vector<string> >& files, map<string, vector<string> >& temp){
723 map<string, vector<string> >::iterator it;
724 for (it = temp.begin(); it != temp.end(); it++) {
725 map<string, vector<string> >::iterator it2 = files.find(it->first);
726 if (it2 == files.end()) { //we do not already have this type so just add it
727 files[it->first] = it->second;
729 for (int i = 0; i < (it->second).size(); i++) {
730 files[it->first].push_back((it->second)[i]);
737 catch(exception& e) {
738 m->errorOut(e, "SffMultipleCommand", "mergeOutputFileList");
742 //**********************************************************************************************************************
743 int SffMultipleCommand::createProcesses(vector<string> sffFiles, vector<string> oligosFiles, string fasta, string name, string group){
745 vector<int> processIDS;
749 //divide the groups between the processors
750 vector<linePair> lines;
751 vector<int> numFilesToComplete;
752 int numFilesPerProcessor = sffFiles.size() / processors;
753 for (int i = 0; i < processors; i++) {
754 int startIndex = i * numFilesPerProcessor;
755 int endIndex = (i+1) * numFilesPerProcessor;
756 if(i == (processors - 1)){ endIndex = sffFiles.size(); }
757 lines.push_back(linePair(startIndex, endIndex));
758 numFilesToComplete.push_back((endIndex-startIndex));
761 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
763 //loop through and create all the processes you want
764 while (process != processors) {
768 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
771 num = driver(sffFiles, oligosFiles, lines[process].start, lines[process].end, fasta + toString(getpid()) + ".temp", name + toString(getpid()) + ".temp", group + toString(getpid()) + ".temp");
773 //pass numSeqs to parent
775 string tempFile = toString(getpid()) + ".num.temp";
776 m->openOutputFile(tempFile, out);
777 out << num << '\t' << outputNames.size() << endl;
778 for (int i = 0; i < outputNames.size(); i++) { out << outputNames[i] << endl; }
783 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
784 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
790 num = driver(sffFiles, oligosFiles, lines[0].start, lines[0].end, fasta, name, group);
792 //force parent to wait until all the processes are done
793 for (int i=0;i<processIDS.size();i++) {
794 int temp = processIDS[i];
798 for (int i=0;i<processIDS.size();i++) {
800 string tempFile = toString(processIDS[i]) + ".num.temp";
801 m->openInputFile(tempFile, in);
803 int tempNum = 0; int outputNamesSize = 0;
804 in >> tempNum >> outputNamesSize; m->gobble(in);
805 for (int j = 0; j < outputNamesSize; j++) {
807 in >> tempName; m->gobble(in);
808 outputNames.push_back(tempName);
810 if (tempNum != numFilesToComplete[i+1]) {
811 m->mothurOut("[ERROR]: main process expected " + toString(processIDS[i]) + " to complete " + toString(numFilesToComplete[i+1]) + " files, and it only reported completing " + toString(tempNum) + ". This will cause file mismatches. The flow files may be too large to process with multiple processors. \n");
814 in.close(); m->mothurRemove(tempFile);
817 m->appendFiles(fasta+toString(processIDS[i])+".temp", fasta); m->mothurRemove(fasta+toString(processIDS[i])+".temp");
818 m->appendFiles(name+toString(processIDS[i])+".temp", name); m->mothurRemove(name+toString(processIDS[i])+".temp");
819 if (makeGroup) { m->appendFiles(group+toString(processIDS[i])+".temp", group); m->mothurRemove(group+toString(processIDS[i])+".temp"); }
826 catch(exception& e) {
827 m->errorOut(e, "ShhherCommand", "createProcesses");
831 //**********************************************************************************************************************