2 * chimerauchimecommand.cpp
5 * Created by westcott on 5/13/11.
6 * Copyright 2011 Schloss Lab. All rights reserved.
10 #include "chimerauchimecommand.h"
11 #include "deconvolutecommand.h"
13 #include "sequence.hpp"
14 #include "referencedb.h"
17 //**********************************************************************************************************************
18 vector<string> ChimeraUchimeCommand::setParameters(){
20 CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
21 CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
22 CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
23 CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup);
24 CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
25 CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
26 CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
27 CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "",false,false); parameters.push_back(pabskew);
28 CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pchimealns);
29 CommandParameter pminh("minh", "Number", "", "0.3", "", "", "",false,false); parameters.push_back(pminh);
30 CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pmindiv);
31 CommandParameter pxn("xn", "Number", "", "8.0", "", "", "",false,false); parameters.push_back(pxn);
32 CommandParameter pdn("dn", "Number", "", "1.4", "", "", "",false,false); parameters.push_back(pdn);
33 CommandParameter pxa("xa", "Number", "", "1", "", "", "",false,false); parameters.push_back(pxa);
34 CommandParameter pchunks("chunks", "Number", "", "4", "", "", "",false,false); parameters.push_back(pchunks);
35 CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "",false,false); parameters.push_back(pminchunk);
36 CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "",false,false); parameters.push_back(pidsmoothwindow);
37 //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
38 CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "",false,false); parameters.push_back(pmaxp);
39 CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps);
40 CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps2);
41 CommandParameter pminlen("minlen", "Number", "", "10", "", "", "",false,false); parameters.push_back(pminlen);
42 CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "",false,false); parameters.push_back(pmaxlen);
43 CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pucl);
44 CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pqueryfract);
46 vector<string> myArray;
47 for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
51 m->errorOut(e, "ChimeraUchimeCommand", "setParameters");
55 //**********************************************************************************************************************
56 string ChimeraUchimeCommand::getHelpString(){
58 string helpString = "";
59 helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
60 helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
61 helpString += "The chimera.uchime command parameters are fasta, name, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
62 helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
63 helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
64 helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
65 helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
66 helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
67 helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
68 helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
69 helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n";
70 helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n";
71 helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n";
72 helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n";
73 helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n";
74 helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n";
75 helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
76 helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
77 helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
78 //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
79 helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
80 helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
81 helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
82 helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n";
83 helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n";
84 helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n";
85 helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n";
87 helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n";
89 helpString += "The chimera.uchime command should be in the following format: \n";
90 helpString += "chimera.uchime(fasta=yourFastaFile, reference=yourTemplate) \n";
91 helpString += "Example: chimera.uchime(fasta=AD.align, reference=silva.gold.align) \n";
92 helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFastaFile).\n";
96 m->errorOut(e, "ChimeraUchimeCommand", "getHelpString");
100 //**********************************************************************************************************************
101 ChimeraUchimeCommand::ChimeraUchimeCommand(){
103 abort = true; calledHelp = true;
105 vector<string> tempOutNames;
106 outputTypes["chimera"] = tempOutNames;
107 outputTypes["accnos"] = tempOutNames;
108 outputTypes["alns"] = tempOutNames;
110 catch(exception& e) {
111 m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand");
115 //***************************************************************************************************************
116 ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
118 abort = false; calledHelp = false;
119 ReferenceDB* rdb = ReferenceDB::getInstance();
121 //allow user to run help
122 if(option == "help") { help(); abort = true; calledHelp = true; }
123 else if(option == "citation") { citation(); abort = true; calledHelp = true;}
126 vector<string> myArray = setParameters();
128 OptionParser parser(option);
129 map<string,string> parameters = parser.getParameters();
131 ValidParameters validParameter("chimera.uchime");
132 map<string,string>::iterator it;
134 //check to make sure all parameters are valid for command
135 for (it = parameters.begin(); it != parameters.end(); it++) {
136 if (validParameter.isValidParameter(it->first, myArray, it->second) != true) { abort = true; }
139 vector<string> tempOutNames;
140 outputTypes["chimera"] = tempOutNames;
141 outputTypes["accnos"] = tempOutNames;
142 outputTypes["alns"] = tempOutNames;
144 //if the user changes the input directory command factory will send this info to us in the output parameter
145 string inputDir = validParameter.validFile(parameters, "inputdir", false);
146 if (inputDir == "not found"){ inputDir = ""; }
148 //check for required parameters
149 fastafile = validParameter.validFile(parameters, "fasta", false);
150 if (fastafile == "not found") {
151 //if there is a current fasta file, use it
152 string filename = m->getFastaFile();
153 if (filename != "") { fastaFileNames.push_back(filename); m->mothurOut("Using " + filename + " as input file for the fasta parameter."); m->mothurOutEndLine(); }
154 else { m->mothurOut("You have no current fastafile and the fasta parameter is required."); m->mothurOutEndLine(); abort = true; }
156 m->splitAtDash(fastafile, fastaFileNames);
158 //go through files and make sure they are good, if not, then disregard them
159 for (int i = 0; i < fastaFileNames.size(); i++) {
162 if (fastaFileNames[i] == "current") {
163 fastaFileNames[i] = m->getFastaFile();
164 if (fastaFileNames[i] != "") { m->mothurOut("Using " + fastaFileNames[i] + " as input file for the fasta parameter where you had given current."); m->mothurOutEndLine(); }
166 m->mothurOut("You have no current fastafile, ignoring current."); m->mothurOutEndLine(); ignore=true;
167 //erase from file list
168 fastaFileNames.erase(fastaFileNames.begin()+i);
175 if (inputDir != "") {
176 string path = m->hasPath(fastaFileNames[i]);
177 //if the user has not given a path then, add inputdir. else leave path alone.
178 if (path == "") { fastaFileNames[i] = inputDir + fastaFileNames[i]; }
184 ableToOpen = m->openInputFile(fastaFileNames[i], in, "noerror");
186 //if you can't open it, try default location
187 if (ableToOpen == 1) {
188 if (m->getDefaultPath() != "") { //default path is set
189 string tryPath = m->getDefaultPath() + m->getSimpleName(fastaFileNames[i]);
190 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
192 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
194 fastaFileNames[i] = tryPath;
198 if (ableToOpen == 1) {
199 if (m->getOutputDir() != "") { //default path is set
200 string tryPath = m->getOutputDir() + m->getSimpleName(fastaFileNames[i]);
201 m->mothurOut("Unable to open " + fastaFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
203 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
205 fastaFileNames[i] = tryPath;
211 if (ableToOpen == 1) {
212 m->mothurOut("Unable to open " + fastaFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
213 //erase from file list
214 fastaFileNames.erase(fastaFileNames.begin()+i);
217 m->setFastaFile(fastaFileNames[i]);
222 //make sure there is at least one valid file left
223 if (fastaFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid files."); m->mothurOutEndLine(); abort = true; }
227 //check for required parameters
229 namefile = validParameter.validFile(parameters, "name", false);
230 if (namefile == "not found") { namefile = ""; hasName = false; }
232 m->splitAtDash(namefile, nameFileNames);
234 //go through files and make sure they are good, if not, then disregard them
235 for (int i = 0; i < nameFileNames.size(); i++) {
238 if (nameFileNames[i] == "current") {
239 nameFileNames[i] = m->getNameFile();
240 if (nameFileNames[i] != "") { m->mothurOut("Using " + nameFileNames[i] + " as input file for the name parameter where you had given current."); m->mothurOutEndLine(); }
242 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
243 //erase from file list
244 nameFileNames.erase(nameFileNames.begin()+i);
251 if (inputDir != "") {
252 string path = m->hasPath(nameFileNames[i]);
253 //if the user has not given a path then, add inputdir. else leave path alone.
254 if (path == "") { nameFileNames[i] = inputDir + nameFileNames[i]; }
260 ableToOpen = m->openInputFile(nameFileNames[i], in, "noerror");
262 //if you can't open it, try default location
263 if (ableToOpen == 1) {
264 if (m->getDefaultPath() != "") { //default path is set
265 string tryPath = m->getDefaultPath() + m->getSimpleName(nameFileNames[i]);
266 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
268 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
270 nameFileNames[i] = tryPath;
274 if (ableToOpen == 1) {
275 if (m->getOutputDir() != "") { //default path is set
276 string tryPath = m->getOutputDir() + m->getSimpleName(nameFileNames[i]);
277 m->mothurOut("Unable to open " + nameFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
279 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
281 nameFileNames[i] = tryPath;
287 if (ableToOpen == 1) {
288 m->mothurOut("Unable to open " + nameFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
289 //erase from file list
290 nameFileNames.erase(nameFileNames.begin()+i);
293 m->setNameFile(nameFileNames[i]);
298 //make sure there is at least one valid file left
299 if (nameFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid name files."); m->mothurOutEndLine(); abort = true; }
302 if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
304 bool hasGroup = true;
305 groupfile = validParameter.validFile(parameters, "group", false);
306 if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
308 m->splitAtDash(groupfile, groupFileNames);
310 //go through files and make sure they are good, if not, then disregard them
311 for (int i = 0; i < groupFileNames.size(); i++) {
314 if (groupFileNames[i] == "current") {
315 groupFileNames[i] = m->getGroupFile();
316 if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
318 m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
319 //erase from file list
320 groupFileNames.erase(groupFileNames.begin()+i);
327 if (inputDir != "") {
328 string path = m->hasPath(groupFileNames[i]);
329 //if the user has not given a path then, add inputdir. else leave path alone.
330 if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
336 ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
338 //if you can't open it, try default location
339 if (ableToOpen == 1) {
340 if (m->getDefaultPath() != "") { //default path is set
341 string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
342 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
344 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
346 groupFileNames[i] = tryPath;
350 if (ableToOpen == 1) {
351 if (m->getOutputDir() != "") { //default path is set
352 string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
353 m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
355 ableToOpen = m->openInputFile(tryPath, in2, "noerror");
357 groupFileNames[i] = tryPath;
363 if (ableToOpen == 1) {
364 m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
365 //erase from file list
366 groupFileNames.erase(groupFileNames.begin()+i);
369 m->setGroupFile(groupFileNames[i]);
374 //make sure there is at least one valid file left
375 if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
378 if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
381 //if the user changes the output directory command factory will send this info to us in the output parameter
382 outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
385 it = parameters.find("reference");
386 //user has given a template file
387 if(it != parameters.end()){
388 if (it->second == "self") { templatefile = "self"; }
390 path = m->hasPath(it->second);
391 //if the user has not given a path then, add inputdir. else leave path alone.
392 if (path == "") { parameters["reference"] = inputDir + it->second; }
394 templatefile = validParameter.validFile(parameters, "reference", true);
395 if (templatefile == "not open") { abort = true; }
396 else if (templatefile == "not found") { //check for saved reference sequences
397 if (rdb->getSavedReference() != "") {
398 templatefile = rdb->getSavedReference();
399 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
401 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
402 m->mothurOutEndLine();
407 }else if (hasName) { templatefile = "self"; }
409 if (rdb->getSavedReference() != "") {
410 templatefile = rdb->getSavedReference();
411 m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
413 m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
414 m->mothurOutEndLine();
415 templatefile = ""; abort = true;
419 string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
420 m->setProcessors(temp);
421 convert(temp, processors);
423 abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
424 if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
426 temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; }
427 chimealns = m->isTrue(temp);
429 minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; }
430 mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; }
431 xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; }
432 dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; }
433 xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; }
434 chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
435 minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
436 idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
437 //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
438 maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
439 minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
440 maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
442 temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; }
443 ucl = m->isTrue(temp);
445 queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; }
446 if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; }
448 temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; }
449 skipgaps = m->isTrue(temp);
451 temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
452 skipgaps2 = m->isTrue(temp);
454 if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
455 if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
459 catch(exception& e) {
460 m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand");
464 //***************************************************************************************************************
466 int ChimeraUchimeCommand::execute(){
468 if (abort == true) { if (calledHelp) { return 0; } return 2; }
470 m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
472 for (int s = 0; s < fastaFileNames.size(); s++) {
474 m->mothurOut("Checking sequences from " + fastaFileNames[s] + " ..." ); m->mothurOutEndLine();
476 int start = time(NULL);
477 string nameFile = "";
478 if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
479 string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
480 string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
481 string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
482 string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
484 //you provided a groupfile
485 string groupFile = "";
486 if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; }
488 if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template
490 if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
491 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
492 nameFile = nameFileNames[s];
493 }else { nameFile = getNamesFile(fastaFileNames[s]); }
495 map<string, string> seqs;
496 readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
499 vector<seqPriorityNode> nameMapCount;
500 int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
501 if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
502 if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
504 printFile(nameMapCount, newFasta);
505 fastaFileNames[s] = newFasta;
508 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
510 if (groupFile != "") {
511 if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
512 nameFile = nameFileNames[s];
513 }else { nameFile = getNamesFile(fastaFileNames[s]); }
515 //Parse sequences by group
516 SequenceParser parser(groupFile, fastaFileNames[s], nameFile);
517 vector<string> groups = parser.getNamesOfGroups();
519 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
522 ofstream out, out1, out2;
523 m->openOutputFile(outputFileName, out); out.close();
524 m->openOutputFile(accnosFileName, out1); out1.close();
525 if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
528 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
529 if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
530 else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); }
532 totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups);
534 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
536 int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName);
538 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
539 m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
541 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
544 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
548 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
549 if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
550 else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
552 numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras);
554 if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
556 //remove file made for uchime
557 if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
559 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
562 outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
563 outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
564 if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
567 //set accnos file as new current accnosfile
569 itTypes = outputTypes.find("accnos");
570 if (itTypes != outputTypes.end()) {
571 if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setAccnosFile(current); }
574 m->mothurOutEndLine();
575 m->mothurOut("Output File Names: "); m->mothurOutEndLine();
576 for (int i = 0; i < outputNames.size(); i++) { m->mothurOut(outputNames[i]); m->mothurOutEndLine(); }
577 m->mothurOutEndLine();
582 catch(exception& e) {
583 m->errorOut(e, "ChimeraUchimeCommand", "execute");
587 //**********************************************************************************************************************
588 int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){
590 map<string, string> uniqueNames = parser.getAllSeqsMap();
591 map<string, string>::iterator itUnique;
596 m->openInputFile(outputFileName, in);
599 m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
602 string name, rest, parent1, parent2;
603 set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
604 set<string>::iterator itNames;
606 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
608 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
609 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
614 if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
616 in >> temp1; m->gobble(in);
617 in >> name; m->gobble(in);
618 in >> parent1; m->gobble(in);
619 in >> parent2; m->gobble(in);
620 rest = m->getline(in); m->gobble(in);
622 //parse name - name will look like U68590/ab=1/
623 string restOfName = "";
624 int pos = name.find_first_of('/');
625 if (pos != string::npos) {
626 restOfName = name.substr(pos);
627 name = name.substr(0, pos);
631 itUnique = uniqueNames.find(name);
633 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
635 itNames = namesInFile.find((itUnique->second));
637 if (itNames == namesInFile.end()) {
638 out << temp1 << '\t' << itUnique->second << restOfName << '\t';
639 namesInFile.insert((itUnique->second));
641 //parse parent1 names
642 if (parent1 != "*") {
644 pos = parent1.find_first_of('/');
645 if (pos != string::npos) {
646 restOfName = parent1.substr(pos);
647 parent1 = parent1.substr(0, pos);
650 itUnique = uniqueNames.find(parent1);
651 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
653 out << itUnique->second << restOfName << '\t';
655 }else { out << parent1 << '\t'; }
657 //parse parent2 names
658 if (parent2 != "*") {
660 pos = parent2.find_first_of('/');
661 if (pos != string::npos) {
662 restOfName = parent2.substr(pos);
663 parent2 = parent2.substr(0, pos);
666 itUnique = uniqueNames.find(parent2);
667 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
669 out << itUnique->second << restOfName << '\t';
671 }else { out << parent2 << '\t'; }
680 m->mothurRemove(outputFileName);
681 rename((outputFileName+".temp").c_str(), outputFileName.c_str());
685 m->openInputFile(accnosFileName, in2);
688 m->openOutputFile(accnosFileName+".temp", out2);
694 if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
696 in2 >> name; m->gobble(in2);
699 itUnique = uniqueNames.find(name);
701 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
703 itNames = namesInFile.find((itUnique->second));
705 if (itNames == namesInFile.end()) {
706 out2 << itUnique->second << endl;
707 namesInFile.insert((itUnique->second));
715 m->mothurRemove(accnosFileName);
716 rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
719 //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
721 ------------------------------------------------------------------------
722 Query ( 179 nt) F21Fcsw_11639/ab=591/
723 ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
724 ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
726 A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
727 Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
728 B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
729 Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
730 Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
731 Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
733 A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
734 Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
735 B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
736 Diffs NNN N N N N N BB NNN
737 Votes 000 0 0 0 0 0 ++ 000
738 Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
740 A 159 TGGAACTGAGACACGGTCCAA 179
741 Q 159 TGGAACTGAGACACGGTCCAA 179
742 B 161 TGGAACTGAGACACGGTCCAA 181
745 Model BBBBBBBBBBBBBBBBBBBBB
747 Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
748 Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
752 m->openInputFile(alnsFileName, in3);
755 m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
762 if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
765 line = m->getline(in3);
769 istringstream iss(line);
772 //are you a name line
773 if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
775 for (int i = 0; i < line.length(); i++) {
777 if (line[i] == ')') { break; }
778 else { out3 << line[i]; }
781 if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
782 else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
784 out << line[spot] << line[spot+1];
786 name = line.substr(spot+2);
788 //parse name - name will either look like U68590/ab=1/ or U68590
789 string restOfName = "";
790 int pos = name.find_first_of('/');
791 if (pos != string::npos) {
792 restOfName = name.substr(pos);
793 name = name.substr(0, pos);
797 itUnique = uniqueNames.find(name);
799 if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
801 //only limit repeats on query names
802 if (temp == "Query") {
803 itNames = namesInFile.find((itUnique->second));
805 if (itNames == namesInFile.end()) {
806 out << itUnique->second << restOfName << endl;
807 namesInFile.insert((itUnique->second));
809 }else { out << itUnique->second << restOfName << endl; }
814 }else { //not need to alter line
815 out3 << line << endl;
817 }else { out3 << endl; }
822 m->mothurRemove(alnsFileName);
823 rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
828 catch(exception& e) {
829 m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
833 //**********************************************************************************************************************
834 int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
837 sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
840 m->openOutputFile(filename, out);
842 //print new file in order of
843 for (int i = 0; i < nameMapCount.size(); i++) {
844 out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
850 catch(exception& e) {
851 m->errorOut(e, "ChimeraUchimeCommand", "printFile");
855 //**********************************************************************************************************************
856 int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
858 //create input file for uchime
859 //read through fastafile and store info
861 m->openInputFile(filename, in);
865 if (m->control_pressed) { in.close(); return 0; }
867 Sequence seq(in); m->gobble(in);
868 seqs[seq.getName()] = seq.getAligned();
874 catch(exception& e) {
875 m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
879 //**********************************************************************************************************************
881 string ChimeraUchimeCommand::getNamesFile(string& inputFile){
883 string nameFile = "";
885 m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
887 //use unique.seqs to create new name and fastafile
888 string inputString = "fasta=" + inputFile;
889 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
890 m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
892 Command* uniqueCommand = new DeconvoluteCommand(inputString);
893 uniqueCommand->execute();
895 map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
897 delete uniqueCommand;
899 m->mothurOut("/******************************************/"); m->mothurOutEndLine();
901 nameFile = filenames["name"][0];
902 inputFile = filenames["fasta"][0];
906 catch(exception& e) {
907 m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
911 //**********************************************************************************************************************
912 int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
918 for (int i = start; i < end; i++) {
919 int start = time(NULL); if (m->control_pressed) { return 0; }
921 int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; }
923 int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
924 totalSeqs += numSeqs;
926 if (m->control_pressed) { return 0; }
928 //remove file made for uchime
929 m->mothurRemove(filename);
932 m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
933 m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
934 if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
936 m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
942 catch(exception& e) {
943 m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
947 //**********************************************************************************************************************
949 int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
954 char* tempUchime = new char[8];
955 strcpy(tempUchime, "./uchime ");
956 cPara.push_back(tempUchime);
958 char* tempIn = new char[8];
959 *tempIn = '\0'; strncat(tempIn, "--input", 7);
960 //strcpy(tempIn, "--input");
961 cPara.push_back(tempIn);
962 char* temp = new char[filename.length()+1];
963 *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
964 //strcpy(temp, filename.c_str());
965 cPara.push_back(temp);
967 //are you using a reference file
968 if (templatefile != "self") {
970 char* tempRef = new char[5];
971 //strcpy(tempRef, "--db");
972 *tempRef = '\0'; strncat(tempRef, "--db", 4);
973 cPara.push_back(tempRef);
974 char* tempR = new char[templatefile.length()+1];
975 //strcpy(tempR, templatefile.c_str());
976 *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
977 cPara.push_back(tempR);
980 char* tempO = new char[12];
981 *tempO = '\0'; strncat(tempO, "--uchimeout", 11);
982 //strcpy(tempO, "--uchimeout");
983 cPara.push_back(tempO);
984 char* tempout = new char[outputFName.length()+1];
985 //strcpy(tempout, outputFName.c_str());
986 *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
987 cPara.push_back(tempout);
990 char* tempA = new char[13];
991 *tempA = '\0'; strncat(tempA, "--uchimealns", 12);
992 //strcpy(tempA, "--uchimealns");
993 cPara.push_back(tempA);
994 char* tempa = new char[alns.length()+1];
995 //strcpy(tempa, alns.c_str());
996 *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
997 cPara.push_back(tempa);
1001 char* tempskew = new char[9];
1002 *tempskew = '\0'; strncat(tempskew, "--abskew", 8);
1003 //strcpy(tempskew, "--abskew");
1004 cPara.push_back(tempskew);
1005 char* tempSkew = new char[abskew.length()+1];
1006 //strcpy(tempSkew, abskew.c_str());
1007 *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
1008 cPara.push_back(tempSkew);
1012 char* tempminh = new char[7];
1013 *tempminh = '\0'; strncat(tempminh, "--minh", 6);
1014 //strcpy(tempminh, "--minh");
1015 cPara.push_back(tempminh);
1016 char* tempMinH = new char[minh.length()+1];
1017 *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
1018 //strcpy(tempMinH, minh.c_str());
1019 cPara.push_back(tempMinH);
1023 char* tempmindiv = new char[9];
1024 *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
1025 //strcpy(tempmindiv, "--mindiv");
1026 cPara.push_back(tempmindiv);
1027 char* tempMindiv = new char[mindiv.length()+1];
1028 *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
1029 //strcpy(tempMindiv, mindiv.c_str());
1030 cPara.push_back(tempMindiv);
1034 char* tempxn = new char[5];
1035 //strcpy(tempxn, "--xn");
1036 *tempxn = '\0'; strncat(tempxn, "--xn", 4);
1037 cPara.push_back(tempxn);
1038 char* tempXn = new char[xn.length()+1];
1039 //strcpy(tempXn, xn.c_str());
1040 *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
1041 cPara.push_back(tempXn);
1045 char* tempdn = new char[5];
1046 //strcpy(tempdn, "--dn");
1047 *tempdn = '\0'; strncat(tempdn, "--dn", 4);
1048 cPara.push_back(tempdn);
1049 char* tempDn = new char[dn.length()+1];
1050 *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
1051 //strcpy(tempDn, dn.c_str());
1052 cPara.push_back(tempDn);
1056 char* tempxa = new char[5];
1057 //strcpy(tempxa, "--xa");
1058 *tempxa = '\0'; strncat(tempxa, "--xa", 4);
1059 cPara.push_back(tempxa);
1060 char* tempXa = new char[xa.length()+1];
1061 *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
1062 //strcpy(tempXa, xa.c_str());
1063 cPara.push_back(tempXa);
1067 char* tempchunks = new char[9];
1068 //strcpy(tempchunks, "--chunks");
1069 *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
1070 cPara.push_back(tempchunks);
1071 char* tempChunks = new char[chunks.length()+1];
1072 *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
1073 //strcpy(tempChunks, chunks.c_str());
1074 cPara.push_back(tempChunks);
1078 char* tempminchunk = new char[11];
1079 //strcpy(tempminchunk, "--minchunk");
1080 *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
1081 cPara.push_back(tempminchunk);
1082 char* tempMinchunk = new char[minchunk.length()+1];
1083 *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
1084 //strcpy(tempMinchunk, minchunk.c_str());
1085 cPara.push_back(tempMinchunk);
1088 if (useIdsmoothwindow) {
1089 char* tempidsmoothwindow = new char[17];
1090 *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
1091 //strcpy(tempidsmoothwindow, "--idsmoothwindow");
1092 cPara.push_back(tempidsmoothwindow);
1093 char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
1094 *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
1095 //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
1096 cPara.push_back(tempIdsmoothwindow);
1099 /*if (useMinsmoothid) {
1100 char* tempminsmoothid = new char[14];
1101 //strcpy(tempminsmoothid, "--minsmoothid");
1102 *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
1103 cPara.push_back(tempminsmoothid);
1104 char* tempMinsmoothid = new char[minsmoothid.length()+1];
1105 *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
1106 //strcpy(tempMinsmoothid, minsmoothid.c_str());
1107 cPara.push_back(tempMinsmoothid);
1111 char* tempmaxp = new char[7];
1112 //strcpy(tempmaxp, "--maxp");
1113 *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
1114 cPara.push_back(tempmaxp);
1115 char* tempMaxp = new char[maxp.length()+1];
1116 *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
1117 //strcpy(tempMaxp, maxp.c_str());
1118 cPara.push_back(tempMaxp);
1122 char* tempskipgaps = new char[13];
1123 //strcpy(tempskipgaps, "--[no]skipgaps");
1124 *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
1125 cPara.push_back(tempskipgaps);
1129 char* tempskipgaps2 = new char[14];
1130 //strcpy(tempskipgaps2, "--[no]skipgaps2");
1131 *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
1132 cPara.push_back(tempskipgaps2);
1136 char* tempminlen = new char[9];
1137 *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
1138 //strcpy(tempminlen, "--minlen");
1139 cPara.push_back(tempminlen);
1140 char* tempMinlen = new char[minlen.length()+1];
1141 //strcpy(tempMinlen, minlen.c_str());
1142 *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
1143 cPara.push_back(tempMinlen);
1147 char* tempmaxlen = new char[9];
1148 //strcpy(tempmaxlen, "--maxlen");
1149 *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
1150 cPara.push_back(tempmaxlen);
1151 char* tempMaxlen = new char[maxlen.length()+1];
1152 *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
1153 //strcpy(tempMaxlen, maxlen.c_str());
1154 cPara.push_back(tempMaxlen);
1158 char* tempucl = new char[5];
1159 strcpy(tempucl, "--ucl");
1160 cPara.push_back(tempucl);
1163 if (useQueryfract) {
1164 char* tempqueryfract = new char[13];
1165 *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
1166 //strcpy(tempqueryfract, "--queryfract");
1167 cPara.push_back(tempqueryfract);
1168 char* tempQueryfract = new char[queryfract.length()+1];
1169 *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
1170 //strcpy(tempQueryfract, queryfract.c_str());
1171 cPara.push_back(tempQueryfract);
1175 char** uchimeParameters;
1176 uchimeParameters = new char*[cPara.size()];
1177 for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; }
1178 int numArgs = cPara.size();
1180 uchime_main(numArgs, uchimeParameters);
1183 for(int i = 0; i < cPara.size(); i++) { delete[] cPara[i]; }
1184 delete[] uchimeParameters;
1186 if (m->control_pressed) { return 0; }
1188 //create accnos file from uchime results
1190 m->openInputFile(outputFName, in);
1193 m->openOutputFile(accnos, out);
1199 if (m->control_pressed) { break; }
1202 string chimeraFlag = "";
1203 in >> chimeraFlag >> name;
1205 //fix name if needed
1206 if (templatefile == "self") {
1207 name = name.substr(0, name.length()-1); //rip off last /
1208 name = name.substr(0, name.find_last_of('/'));
1211 for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
1214 if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
1222 catch(exception& e) {
1223 m->errorOut(e, "ChimeraUchimeCommand", "driver");
1227 /**************************************************************************************************/
1229 int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
1235 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1236 //break up file into multiple files
1237 vector<string> files;
1238 m->divideFile(filename, processors, files);
1240 if (m->control_pressed) { return 0; }
1242 //loop through and create all the processes you want
1243 while (process != processors) {
1247 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1249 }else if (pid == 0){
1250 num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
1252 //pass numSeqs to parent
1254 string tempFile = outputFileName + toString(getpid()) + ".num.temp";
1255 m->openOutputFile(tempFile, out);
1257 out << numChimeras << endl;
1262 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1263 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1269 num = driver(outputFileName, files[0], accnos, alns, numChimeras);
1271 //force parent to wait until all the processes are done
1272 for (int i=0;i<processIDS.size();i++) {
1273 int temp = processIDS[i];
1277 for (int i = 0; i < processIDS.size(); i++) {
1279 string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
1280 m->openInputFile(tempFile, in);
1283 in >> tempNum; m->gobble(in);
1286 numChimeras += tempNum;
1288 in.close(); m->mothurRemove(tempFile);
1292 //append output files
1293 for(int i=0;i<processIDS[i];i++){
1294 m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
1295 m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
1297 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1298 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1301 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1302 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1306 //get rid of the file pieces.
1307 for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
1311 catch(exception& e) {
1312 m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
1316 /**************************************************************************************************/
1318 int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector<string> groups) {
1326 if (groups.size() < processors) { processors = groups.size(); }
1328 //divide the groups between the processors
1329 vector<linePair> lines;
1330 int numGroupsPerProcessor = groups.size() / processors;
1331 for (int i = 0; i < processors; i++) {
1332 int startIndex = i * numGroupsPerProcessor;
1333 int endIndex = (i+1) * numGroupsPerProcessor;
1334 if(i == (processors - 1)){ endIndex = groups.size(); }
1335 lines.push_back(linePair(startIndex, endIndex));
1338 #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
1340 //loop through and create all the processes you want
1341 while (process != processors) {
1345 processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
1347 }else if (pid == 0){
1348 num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
1350 //pass numSeqs to parent
1352 string tempFile = outputFName + toString(getpid()) + ".num.temp";
1353 m->openOutputFile(tempFile, out);
1359 m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
1360 for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
1366 num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
1368 //force parent to wait until all the processes are done
1369 for (int i=0;i<processIDS.size();i++) {
1370 int temp = processIDS[i];
1375 for (int i = 0; i < processIDS.size(); i++) {
1377 string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
1378 m->openInputFile(tempFile, in);
1379 if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
1380 in.close(); m->mothurRemove(tempFile);
1384 //append output files
1385 for(int i=0;i<processIDS[i];i++){
1386 m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
1387 m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
1389 m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
1390 m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
1393 m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
1394 m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
1401 catch(exception& e) {
1402 m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
1406 /**************************************************************************************************/