--- /dev/null
+# Copyright (C) 2007-2011 Martin A. Hansen.
+
+# This program is free software; you can redistribute it and/or
+# modify it under the terms of the GNU General Public License
+# as published by the Free Software Foundation; either version 2
+# of the License, or (at your option) any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
+
+# http://www.gnu.org/copyleft/gpl.html
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# This software is part of the Biopieces framework (www.biopieces.org).
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# IUPAC nucleotide pair ambiguity equivalents
+EQUAL = {
+ :AA => true, :BU => true, :TH => true, :UY => true,
+ :TT => true, :CB => true, :UH => true, :SC => true,
+ :CC => true, :GB => true, :VA => true, :SG => true,
+ :GG => true, :TB => true, :VC => true, :CS => true,
+ :UU => true, :UB => true, :VG => true, :GS => true,
+ :NA => true, :DA => true, :AV => true, :WA => true,
+ :NT => true, :DG => true, :CV => true, :WT => true,
+ :NC => true, :DT => true, :GV => true, :WU => true,
+ :NG => true, :DU => true, :KG => true, :AW => true,
+ :NU => true, :AD => true, :KT => true, :TW => true,
+ :AN => true, :GD => true, :KU => true, :UW => true,
+ :TN => true, :TD => true, :GK => true, :RA => true,
+ :CN => true, :UD => true, :TK => true, :RG => true,
+ :GN => true, :HA => true, :UK => true, :AR => true,
+ :UN => true, :HC => true, :YC => true, :GR => true,
+ :NN => true, :HT => true, :YT => true, :MA => true,
+ :BC => true, :HU => true, :YU => true, :MC => true,
+ :BG => true, :AH => true, :CY => true, :AM => true,
+ :BT => true, :CH => true, :TY => true, :CM => true,
+}
+
+# Module containing code to locate nucleotide patterns in sequences allowing for
+# ambiguity codes and a given maximum number of mismatches, insertions, and deletions.
+# Insertions are nucleotides found in the pattern but not in the sequence.
+# Deletions are nucleotides found in the sequence but not in the pattern.
+module PatternMatcher
+ # ------------------------------------------------------------------------------
+ # str.match(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]])
+ # -> Match or nil
+ #
+ # ------------------------------------------------------------------------------
+ # Method to locate the next pattern match starting from a given position.
+ # A match is located by exploring all possible paths allowing for a given
+ # maximum number of mismatches, insertions and deletions. If a match is
+ # located a Match object will be returned. If all paths are exhausted and
+ # no match is located the position is incremented. If no match is located
+ # whatsoever, then nil is returned.
+ # TODO: converging paths should be skipped for speed-up.
+ def match(pattern, pos = 0, max_mismatches = 0, max_insertions = 0, max_deletions = 0)
+ @pattern = pattern
+ @max_mismatches = max_mismatches
+ @max_insertions = max_insertions
+ @max_deletions = max_deletions
+
+ while pos <= @seq.length - @pattern.length + @max_insertions
+ paths = []
+ paths << Path.new(pos, seq_index = pos, pattern_index = 0)
+
+ while not paths.empty?
+ new_paths = []
+
+ paths.each do |path|
+ next if path.exhausted?(@seq, @pattern)
+ return path.to_match if match_found?(path)
+
+ if path.match?(@seq, @pattern)
+ new_paths << path.match
+ elsif path.mismatches < max_mismatches
+ new_paths << path.mismatch
+ end
+
+ new_paths << path.insertion if path.insertions < max_insertions
+ new_paths << path.deletion if path.deletions < max_deletions
+ end
+
+ paths = new_paths
+ end
+
+ pos += 1
+ end
+ end
+
+ # ------------------------------------------------------------------------------
+ # str.scan(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]])
+ # -> Array
+ # str.scan(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]]) { |match|
+ # block
+ # }
+ # -> Match
+ #
+ # ------------------------------------------------------------------------------
+ # Method to iterate through a sequence to locate pattern matches starting
+ # from a given position. A match is located by exploring all possible paths
+ # allowing for a given maximum number of mismatches, insertions and deletions.
+ # Matches found in block context return the Match object. Otherwise matches are
+ # returned in an Array.
+ def scan(pattern, pos = 0, max_mismatches = 0, max_insertions = 0, max_deletions = 0)
+ matches = []
+ offset = pos
+
+ while match = match(pattern, offset, max_mismatches, max_insertions, max_deletions)
+ if block_given?
+ yield match
+ else
+ matches << match
+ end
+
+ offset = match.pos + 1
+ end
+
+ return matches unless block_given?
+ end
+
+ private
+
+ # Method to check if a path is complete and a match was found.
+ def match_found?(path)
+ if path.mismatches <= @max_mismatches and path.insertions <= @max_insertions and path.deletions <= @max_deletions
+ if path.matches + path.mismatches + path.insertions >= @pattern.length
+ true
+ end
+ end
+ end
+
+ # Class for describing a path for matching a nucleotide sequence and a pattern.
+ class Path
+ attr_accessor :pos, :seq_index, :pattern_index, :matches, :mismatches, :insertions, :deletions, :length
+
+ def initialize(pos, seq_index, pattern_index, matches = 0, mismatches = 0, insertions = 0, deletions = 0, length = 0)
+ @pos = pos
+ @seq_index = seq_index
+ @pattern_index = pattern_index
+ @matches = matches
+ @mismatches = mismatches
+ @insertions = insertions
+ @deletions = deletions
+ @length = length
+ end
+
+ # Method to check if nucleotides match.
+ def match?(seq, pattern)
+ EQUAL["#{seq[self.seq_index]}#{pattern[self.pattern_index]}".upcase.to_sym]
+ end
+
+ # Method to check if the path is exhausted.
+ def exhausted?(seq, pattern)
+ if self.seq_index - self.insertions > seq.length
+ true
+ elsif self.pattern_index > pattern.length
+ true
+ end
+ end
+
+ # Method that returns a Match object created from a Path object.
+ def to_match
+ Match.new(@pos, @matches, @mismatches, @insertions, @deletions, @length)
+ end
+
+ # Method that returns a new Match object for a matching path
+ def match
+ path_match = self.dup
+ path_match.length += 1
+ path_match.matches += 1
+ path_match.seq_index += 1
+ path_match.pattern_index += 1
+ path_match
+ end
+
+ # Method that returns a new Match object for a matching path
+ def mismatch
+ path_mismatche = self.dup
+ path_mismatche.length += 1
+ path_mismatche.mismatches += 1
+ path_mismatche.seq_index += 1
+ path_mismatche.pattern_index += 1
+ path_mismatche
+ end
+
+ # Method that returns a new Match object for a insertion path
+ def insertion
+ path_insertion = self.dup
+ path_insertion.insertions += 1
+ path_insertion.pattern_index += 1
+ path_insertion
+ end
+
+ # Method that returns a new Match object for a deletion path
+ def deletion
+ path_deletion = self.dup
+ path_deletion.length += 1
+ path_deletion.deletions += 1
+ path_deletion.seq_index += 1
+ path_deletion
+ end
+ end
+
+ # Class for creating Match objects which contain the description of a
+ # match between a nucleotide sequence and a pattern.
+ class Match
+ attr_reader :pos, :matches, :mismatches, :insertions, :deletions, :length
+
+ def initialize(pos, matches, mismatches, insertions, deletions, length)
+ @pos = pos
+ @matches = matches
+ @mismatches = mismatches
+ @insertions = insertions
+ @deletions = deletions
+ @length = length
+ end
+ end
+end
require 'amatch'
require 'digest'
-require 'narray'
+require 'patternmatcher'
# Residue alphabets
DNA = %w[a t c g]
SCORE_PHRED = 33
SCORE_ILLUMINA = 64
-# IUPAC nucleotide pair ambiguity equivalents
-EQUAL = {
- :AA => true, :BU => true, :TH => true, :UY => true,
- :TT => true, :CB => true, :UH => true, :SC => true,
- :CC => true, :GB => true, :VA => true, :SG => true,
- :GG => true, :TB => true, :VC => true, :CS => true,
- :UU => true, :UB => true, :VG => true, :GS => true,
- :NA => true, :DA => true, :AV => true, :WA => true,
- :NT => true, :DG => true, :CV => true, :WT => true,
- :NC => true, :DT => true, :GV => true, :WU => true,
- :NG => true, :DU => true, :KG => true, :AW => true,
- :NU => true, :AD => true, :KT => true, :TW => true,
- :AN => true, :GD => true, :KU => true, :UW => true,
- :TN => true, :TD => true, :GK => true, :RA => true,
- :CN => true, :UD => true, :TK => true, :RG => true,
- :GN => true, :HA => true, :UK => true, :AR => true,
- :UN => true, :HC => true, :YC => true, :GR => true,
- :NN => true, :HT => true, :YT => true, :MA => true,
- :BC => true, :HU => true, :YU => true, :MC => true,
- :BG => true, :AH => true, :CY => true, :AM => true,
- :BT => true, :CH => true, :TY => true, :CM => true,
-}
-
# Error class for all exceptions to do with Seq.
class SeqError < StandardError; end
class Seq
include Amatch
+ include PatternMatcher
attr_accessor :seq_name, :seq, :type, :qual
end
end
- # ------------------------------------------------------------------------------
- # seq.match(pattern[, pos ] [, hd=max] [, ed=max]) -> matchdata or nil
- # ------------------------------------------------------------------------------
- # Method to locate a pattern in a sequence and return the position of the match
- # or nil if no match was found. Hamming or Edit distance may be specified.
- def match(pattern, pos = 0, hd = 0, ed = 0)
- while pos < self.length - pattern.length + 1
- if ed == 0
- match = 0
- mis = 0
-
- for i in 0 ... pattern.length do
- EQUAL[(self.seq[pos + i].upcase + pattern[i].upcase).to_sym] ? match += 1 : mis += 1
-
- break if mis > hd
- end
-
- if pattern.length - hd == match
- return pos
- else
- pos += (match - hd >= 0) ? 1 + match - hd : 1
- end
- else
- str1 = self.seq[pos ... pos + pattern.length]
- str2 = pattern
-
- rows = str1.length + 1
- cols = str2.length + 1
-
- matrix = NArray.int(rows, cols)
-
- for i in 0 ... rows do matrix[i, 0] = i end
- for j in 0 ... cols do matrix[0, j] = j end
-
- for j in 1 ... cols do
- for i in 1 ... rows do
- if EQUAL[(str1[i - 1].upcase + str2[j - 1].upcase).to_sym]
- matrix[i, j] = matrix[i - 1, j - 1]
- else
- del = matrix[i - 1, j] + 1
- ins = matrix[i, j - 1] + 1
- mis = matrix[i - 1, j - 1] + 1
-
- matrix[i, j] = [del, ins, mis].min
- end
- end
- end
-
- return pos if matrix[rows - 1, cols - 1] <= ed
-
- pos += 1
- end
- end
- end
-
private
# Method to convert a Solexa score (odd ratio) to
(score_phred + 64).chr
end
end
+
+__END__
--- /dev/null
+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__),'..','lib')
+
+# Copyright (C) 2007-2010 Martin A. Hansen.
+
+# This program is free software; you can redistribute it and/or
+# modify it under the terms of the GNU General Public License
+# as published by the Free Software Foundation; either version 2
+# of the License, or (at your option) any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
+
+# http://www.gnu.org/copyleft/gpl.html
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# This software is part of the Biopieces framework (www.biopieces.org).
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+require 'seq'
+require 'test/unit'
+require 'pp'
+
+class TestPatternMatcher < Test::Unit::TestCase
+ def setup
+ @entry = Seq.new("test", "atcg")
+ end
+
+ def test_PatternMatcher_match_with_perfect_match_returns_ok
+ assert_equal(4, @entry.match("atcg").matches)
+ assert_equal(2, @entry.match("cg").matches)
+ end
+
+ def test_PatternMatcher_match_with_perfect_match_with_ambiguity_returns_ok
+ assert_equal(4, @entry.match("aNcg").matches)
+ end
+
+ def test_PatternMatcher_match_with_fail_match_returns_nil
+ assert_nil(@entry.match("gggg"))
+ end
+
+ def test_PatternMatcher_match_with_one_mismatch_with_zero_allowed_returns_nil
+ assert_nil(@entry.match("aAcg"))
+ end
+
+ def test_PatternMatcher_match_with_one_mismatch_with_one_allowed_returns_ok
+ assert_equal(1, @entry.match("aGcg", pos = 0, mismatches = 1).mismatches)
+ end
+
+ def test_PatternMatcher_match_with_two_mismatch_with_one_allowed_returns_nil
+ assert_nil(@entry.match("CtcA", pos = 0, mismatches = 1))
+ end
+
+ def test_PatternMatcher_match_with_two_mismatch_with_two_allowed_returns_ok
+ assert_equal(2, @entry.match("CtcA", pos = 0, mismatches = 2).mismatches)
+ end
+
+ def test_PatternMatcher_match_with_one_insertion_with_zero_allowed_returns_nil
+ assert_nil(@entry.match("atTcg", pos = 0, mismatches = 0, insertions = 0))
+ assert_nil(@entry.match("Tatcg", pos = 0, mismatches = 0, insertions = 0))
+ assert_nil(@entry.match("atcgT", pos = 0, mismatches = 0, insertions = 0))
+ end
+
+ def test_PatternMatcher_match_with_one_insertion_with_one_allowed_returns_ok
+ assert_equal(1, @entry.match("atTcg", pos = 0, mismatches = 0, insertions = 1).insertions)
+ end
+
+ def test_PatternMatcher_match_with_two_insertion_with_one_allowed_returns_nil
+ assert_nil(@entry.match("aCCtcg", pos = 0, mismatches = 0, insertions = 1))
+ assert_nil(@entry.match("CCatcg", pos = 0, mismatches = 0, insertions = 1))
+ assert_nil(@entry.match("atcgCC", pos = 0, mismatches = 0, insertions = 1))
+ assert_nil(@entry.match("CatcgC", pos = 0, mismatches = 0, insertions = 1))
+ end
+
+ def test_PatternMatcher_match_with_two_insertion_with_two_allowed_returns_ok
+ assert_equal(2, @entry.match("aCCtcg", pos = 0, mismatches = 0, insertions = 2).insertions)
+ assert_equal(2, @entry.match("CCatcg", pos = 0, mismatches = 0, insertions = 2).insertions)
+ assert_equal(2, @entry.match("atcgCC", pos = 0, mismatches = 0, insertions = 2).insertions)
+ assert_equal(2, @entry.match("CatcgC", pos = 0, mismatches = 0, insertions = 2).insertions)
+ end
+
+ def test_PatternMatcher_match_with_one_deletion_with_zero_allowed_returns_nil
+ assert_nil(@entry.match("acg"))
+ assert_nil(@entry.match("atg"))
+ end
+
+ def test_PatternMatcher_match_with_one_deletion_with_one_allowed_returns_ok
+ assert_equal(1, @entry.match("tcg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions)
+ assert_equal(1, @entry.match("acg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions)
+ assert_equal(1, @entry.match("atg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions)
+ end
+
+ def test_PatternMatcher_match_with_two_deletion_with_one_allowed_returns_nil
+ assert_nil(@entry.match("ag", pos = 0, mismatchses = 0, insertions = 0, deletions = 1))
+ end
+
+ def test_PatternMatcher_match_with_two_deletion_with_two_allowed_returns_ok
+ assert_equal(2, @entry.match("cg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions)
+ assert_equal(2, @entry.match("tg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions)
+ assert_equal(2, @entry.match("ag", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions)
+ end
+
+ def test_PatternMatcher_match_with_one_mismatch_one_insertions_one_deletion_returns_ok
+ assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).mismatches)
+ assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).insertions)
+ assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).deletions)
+ end
+
+ # atcgagctagctagctagctgactac
+ # ax
+ # t x
+ # g i
+ # g i
+ # c x
+ # g x
+ #
+ # at--cg
+ # || ||
+ # atggcg
+ def test_PatternMatcher_match_with_two_insertions_and_two_allowed_returns_ok
+ entry = Seq.new("test", "atcgagctagctagctagctgactac")
+ assert_equal(2, entry.match("atggcg", pos = 0, mismatchses = 0, insertions = 2, deletions = 0).insertions)
+ end
+
+ # atggcgagctagctagctagctgactac
+ # ax
+ # t xdd
+ # c x
+ # g x
+ #
+ # atggcg
+ # || ||
+ # at--cg
+ def test_PatternMatcher_match_with_two_deletions_and_two_allowed_returns_ok
+ entry = Seq.new("test", "atggcgagctagctagctagctgactac")
+ assert_equal(2, entry.match("atcg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions)
+ end
+
+ # ataacgagctagctagctagctgactac
+ # ax
+ # gi
+ # t xdd
+ # c x
+ # g x
+ #
+ # a-taacg
+ # | | ||
+ # agt--cg
+ def test_PatternMatcher_match_with_one_insertions_and_two_deletions_all_allowed_returns_ok
+ entry = Seq.new("test", "ataacgagctagctagctagctgactac")
+ assert_equal(1, entry.match("agtcg", pos = 0, mismatchses = 0, insertions = 1, deletions = 2).insertions)
+ assert_equal(2, entry.match("agtcg", pos = 0, mismatchses = 0, insertions = 1, deletions = 2).deletions)
+ end
+
+ def test_Pattern_Matcher_scan_locates_three_patterns_ok
+ entry = Seq.new("test", "ataacgagctagctagctagctgactac")
+ assert_equal(3, entry.scan("tag").count)
+ end
+
+ def test_Pattern_Matcher_scan_with_pos_locates_two_patterns_ok
+ entry = Seq.new("test", "ataacgagctagctagctagctgactac")
+ assert_equal(2, entry.scan("tag", 10).count)
+ end
+end
@entry.adaptor_clip_left("cgax", 25)
assert_equal( "efghi", @entry.qual)
end
-
- def test_Seq_match_with_no_match_returns_nil
- @entry.seq = "atcg"
- assert_equal(nil, @entry.match("ttt"))
- end
-
- def test_Seq_match_returns_correctly
- @entry.seq = "atcgatct"
- assert_equal(0, @entry.match("aTc"))
- assert_equal(4, @entry.match("aNct"))
- end
-
- def test_Seq_match_with_pos_returns_correctly
- @entry.seq = "atcatc"
- assert_equal(3, @entry.match("aTc", 2))
- end
-
- def test_Seq_match_with_hamming_dist_returns_correctly
- @entry.seq = "atcg"
- assert_equal(0, @entry.match("XTCG", pos=0, hd=1))
- assert_equal(0, @entry.match("TTCX", pos=0, hd=2))
- assert_equal(0, @entry.match("XXCX", pos=0, hd=3))
- assert_equal(0, @entry.match("XXXX", pos=0, hd=4))
- end
-
- def test_Seq_match_with_pos_and_hamming_dist_returns_correctly
- @entry.seq = "atcgttcg"
- assert_equal(4, @entry.match("ATCG", pos=1, hd=1))
- end
end