try {
CommandParameter pflow("flow", "InputTypes", "", "", "none", "none", "none","flow-file",false,true,true); parameters.push_back(pflow);
CommandParameter poligos("oligos", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(poligos);
+ CommandParameter preorient("checkorient", "Boolean", "", "F", "", "", "","",false,false,true); parameters.push_back(preorient);
CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop);
CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows);
CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows);
CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal);
CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise);
CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles);
- CommandParameter porder("order", "Multiple", "A-B", "A", "", "", "","",false,false, true); parameters.push_back(porder);
+ CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder);
CommandParameter pfasta("fasta", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pfasta);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir);
try {
string helpString = "";
helpString += "The trim.flows command reads a flowgram file and creates .....\n";
+ helpString += "The oligos parameter allows you to provide an oligos file.\n";
+ helpString += "The maxhomop parameter allows you to set a maximum homopolymer length. \n";
+ helpString += "The tdiffs parameter is used to specify the total number of differences allowed in the sequence. The default is pdiffs + bdiffs + sdiffs + ldiffs.\n";
+ helpString += "The checkorient parameter will check look for the reverse compliment of the barcode or primer in the sequence. The default is false.\n";
+ helpString += "The bdiffs parameter is used to specify the number of differences allowed in the barcode. The default is 0.\n";
+ helpString += "The pdiffs parameter is used to specify the number of differences allowed in the primer. The default is 0.\n";
+ helpString += "The ldiffs parameter is used to specify the number of differences allowed in the linker. The default is 0.\n";
+ helpString += "The sdiffs parameter is used to specify the number of differences allowed in the spacer. The default is 0.\n";
+ helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n";
helpString += "Note: No spaces between parameter labels (i.e. fasta), '=' and parameters (i.e.yourFasta).\n";
helpString += "For more details please check out the wiki http://www.mothur.org/wiki/Trim.flows.\n";
return helpString;
if(oligoFileName == "") { allFiles = 0; }
else { allFiles = 1; }
+
+ temp = validParameter.validFile(parameters, "checkorient", false); if (temp == "not found") { temp = "F"; }
+ reorient = m->isTrue(temp);
numFPrimers = 0;
numRPrimers = 0;
if(line->start == 0){
flowFile >> numFlows; m->gobble(flowFile);
- scrapFlowFile << maxFlows << endl;
+ scrapFlowFile << numFlows << endl;
trimFlowFile << maxFlows << endl;
if(allFiles){
for(int i=0;i<thisBarcodePrimerComboFileNames.size();i++){
int count = 0;
bool moreSeqs = 1;
- TrimOligos trimOligos(pdiffs, bdiffs, ldiffs, sdiffs, primers, barcodes, revPrimer, linker, spacer);
+ TrimOligos* trimOligos = NULL;
+ if (pairedOligos) { trimOligos = new TrimOligos(pdiffs, bdiffs, 0, 0, oligos.getPairedPrimers(), oligos.getPairedBarcodes()); }
+ else { trimOligos = new TrimOligos(pdiffs, bdiffs, ldiffs, sdiffs, oligos.getPrimers(), oligos.getBarcodes(), oligos.getReversePrimers(), oligos.getLinkers(), oligos.getSpacers()); }
+
+ TrimOligos* rtrimOligos = NULL;
+ if (reorient) {
+ rtrimOligos = new TrimOligos(pdiffs, bdiffs, 0, 0, oligos.getReorientedPairedPrimers(), oligos.getReorientedPairedBarcodes()); numBarcodes = oligos.getReorientedPairedBarcodes().size();
+ }
+
while(moreSeqs) {
flowData.capFlows(maxFlows);
Sequence currSeq = flowData.getSequence();
+ //for reorient
+ Sequence savedSeq(currSeq.getName(), currSeq.getAligned());
+
if(!flowData.hasMinFlows(minFlows)){ //screen to see if sequence is of a minimum number of flows
success = 0;
trashCode += 'l';
}
-
+ if(!flowData.hasGoodHomoP()){ //screen to see if sequence meets the maximum homopolymer limit
+ success = 0;
+ trashCode += 'h';
+ }
+
int primerIndex = 0;
int barcodeIndex = 0;
if(numLinkers != 0){
- success = trimOligos.stripLinker(currSeq);
+ success = trimOligos->stripLinker(currSeq);
if(success > ldiffs) { trashCode += 'k'; }
else{ currentSeqDiffs += success; }
if (m->debug) { m->mothurOut("[DEBUG]: " + currSeq.getName() + " " + currSeq.getUnaligned() + "\n"); }
- if(barcodes.size() != 0){
- success = trimOligos.stripBarcode(currSeq, barcodeIndex);
+ if(numBarcodes != 0){
+ success = trimOligos->stripBarcode(currSeq, barcodeIndex);
if(success > bdiffs) { trashCode += 'b'; }
else{ currentSeqDiffs += success; }
}
if(numSpacers != 0){
- success = trimOligos.stripSpacer(currSeq);
+ success = trimOligos->stripSpacer(currSeq);
if(success > sdiffs) { trashCode += 's'; }
else{ currentSeqDiffs += success; }
}
if(numFPrimers != 0){
- success = trimOligos.stripForward(currSeq, primerIndex);
+ success = trimOligos->stripForward(currSeq, primerIndex);
if(success > pdiffs) { trashCode += 'f'; }
else{ currentSeqDiffs += success; }
}
if (currentSeqDiffs > tdiffs) { trashCode += 't'; }
if(numRPrimers != 0){
- success = trimOligos.stripReverse(currSeq);
+ success = trimOligos->stripReverse(currSeq);
if(!success) { trashCode += 'r'; }
}
-
- if(trashCode.length() == 0){
- string thisGroup = "";
- if(barcodes.size() != 0){
- thisGroup = barcodeNameVector[barcodeIndex];
- if (primers.size() != 0) {
- if (primerNameVector[primerIndex] != "") {
- if(thisGroup != "") {
- thisGroup += "." + primerNameVector[primerIndex];
- }else {
- thisGroup = primerNameVector[primerIndex];
- }
- }
- }
+
+ if (reorient && (trashCode != "")) { //if you failed and want to check the reverse
+ int thisSuccess = 0;
+ string thisTrashCode = "";
+ int thisCurrentSeqsDiffs = 0;
+
+ int thisBarcodeIndex = 0;
+ int thisPrimerIndex = 0;
+ //cout << currSeq.getName() << '\t' << savedSeq.getUnaligned() << endl;
+ if(numBarcodes != 0){
+ thisSuccess = rtrimOligos->stripBarcode(savedSeq, thisBarcodeIndex);
+ if(thisSuccess > bdiffs) { thisTrashCode += "b"; }
+ else{ thisCurrentSeqsDiffs += thisSuccess; }
+ }
+ //cout << currSeq.getName() << '\t' << savedSeq.getUnaligned() << endl;
+ if(numFPrimers != 0){
+ thisSuccess = rtrimOligos->stripForward(savedSeq, thisPrimerIndex);
+ if(thisSuccess > pdiffs) { thisTrashCode += "f"; }
+ else{ thisCurrentSeqsDiffs += thisSuccess; }
}
+ if (thisCurrentSeqsDiffs > tdiffs) { thisTrashCode += 't'; }
+
+ if (thisTrashCode == "") {
+ trashCode = thisTrashCode;
+ success = thisSuccess;
+ currentSeqDiffs = thisCurrentSeqsDiffs;
+ barcodeIndex = thisBarcodeIndex;
+ primerIndex = thisPrimerIndex;
+ savedSeq.reverseComplement();
+ currSeq.setAligned(savedSeq.getAligned());
+ }else { trashCode += "(" + thisTrashCode + ")"; }
+ }
+
+ if(trashCode.length() == 0){
+ string thisGroup = oligos.getGroupName(barcodeIndex, primerIndex);
+
int pos = thisGroup.find("ignore");
if (pos == string::npos) {
flowData.printFlows(trimFlowFile);
- if(fasta) { currSeq.printSequence(fastaFile); }
+ if(fasta) { currSeq.printSequence(fastaFile); }
if(allFiles){
ofstream output;
scrapFlowFile.close();
flowFile.close();
if(fasta){ fastaFile.close(); }
+ delete trimOligos;
+ if (reorient) { delete rtrimOligos; }
return count;
}
//***************************************************************************************************************
-void TrimFlowsCommand::getOligos(vector<vector<string> >& outFlowFileNames){
+int TrimFlowsCommand::getOligos(vector<vector<string> >& outFlowFileNames){
try {
- ifstream oligosFile;
- m->openInputFile(oligoFileName, oligosFile);
-
- string type, oligo, group;
-
- int indexPrimer = 0;
- int indexBarcode = 0;
-
- while(!oligosFile.eof()){
-
- oligosFile >> type; m->gobble(oligosFile); //get the first column value of the row - is it a comment or a feature we are interested in?
-
- if(type[0] == '#'){ //igore the line because there's a comment
- while (!oligosFile.eof()) { char c = oligosFile.get(); if (c == 10 || c == 13){ break; } } // get rest of line if there's any crap there
- }
- else{ //there's a feature we're interested in
-
- for(int i=0;i<type.length();i++){ type[i] = toupper(type[i]); } //make type case insensitive
-
- oligosFile >> oligo; //get the DNA sequence for the feature
-
- for(int i=0;i<oligo.length();i++){ //make type case insensitive and change any U's to T's
- oligo[i] = toupper(oligo[i]);
- if(oligo[i] == 'U') { oligo[i] = 'T'; }
- }
-
- if(type == "FORWARD"){ //if the feature is a forward primer...
- group = "";
-
- while (!oligosFile.eof()) { // get rest of line in case there is a primer name = will have the name of the primer
- char c = oligosFile.get();
- if (c == 10 || c == 13){ break; }
- else if (c == 32 || c == 9){;} //space or tab
- else { group += c; }
- }
-
- //have we seen this primer already?
- map<string, int>::iterator itPrimer = primers.find(oligo);
- if (itPrimer != primers.end()) { m->mothurOut("primer " + oligo + " is in your oligos file already."); m->mothurOutEndLine(); }
-
- primers[oligo]=indexPrimer; indexPrimer++;
- primerNameVector.push_back(group);
-
- }
- else if(type == "REVERSE"){
- string oligoRC = reverseOligo(oligo);
- revPrimer.push_back(oligoRC);
- }
- else if(type == "BARCODE"){
- oligosFile >> group;
-
- //check for repeat barcodes
- map<string, int>::iterator itBar = barcodes.find(oligo);
- if (itBar != barcodes.end()) { m->mothurOut("barcode " + oligo + " is in your oligos file already."); m->mothurOutEndLine(); }
-
- barcodes[oligo]=indexBarcode; indexBarcode++;
- barcodeNameVector.push_back(group);
- }else if(type == "LINKER"){
- linker.push_back(oligo);
- }else if(type == "SPACER"){
- spacer.push_back(oligo);
- }
- else{
- m->mothurOut(type + " is not recognized as a valid type. Choices are forward, reverse, and barcode. Ignoring " + oligo + "."); m->mothurOutEndLine();
- }
- }
-
- m->gobble(oligosFile);
- }
- oligosFile.close();
-
- if(barcodeNameVector.size() == 0 && primerNameVector[0] == ""){ allFiles = 0; }
-
- //add in potential combos
- if(barcodeNameVector.size() == 0){
- barcodes[""] = 0;
- barcodeNameVector.push_back("");
- }
-
- if(primerNameVector.size() == 0){
- primers[""] = 0;
- primerNameVector.push_back("");
- }
-
-
- outFlowFileNames.resize(barcodeNameVector.size());
+ bool allBlank = false;
+ oligos.read(oligoFileName);
+
+ if (m->control_pressed) { return 0; } //error in reading oligos
+
+ if (oligos.hasPairedBarcodes()) {
+ pairedOligos = true;
+ numFPrimers = oligos.getPairedPrimers().size();
+ numBarcodes = oligos.getPairedBarcodes().size();
+ }else {
+ pairedOligos = false;
+ numFPrimers = oligos.getPrimers().size();
+ numBarcodes = oligos.getBarcodes().size();
+ }
+
+ numLinkers = oligos.getLinkers().size();
+ numSpacers = oligos.getSpacers().size();
+ numRPrimers = oligos.getReversePrimers().size();
+
+ vector<string> groupNames = oligos.getGroupNames();
+ if (groupNames.size() == 0) { allFiles = 0; allBlank = true; }
+
+
+ outFlowFileNames.resize(oligos.getBarcodeNames().size());
for(int i=0;i<outFlowFileNames.size();i++){
- outFlowFileNames[i].assign(primerNameVector.size(), "");
+ for(int j=0;j<oligos.getPrimerNames().size();j++){ outFlowFileNames[i].push_back(""); }
}
-
- if(allFiles){
-
- for(map<string, int>::iterator itBar = barcodes.begin();itBar != barcodes.end();itBar++){
- for(map<string, int>::iterator itPrimer = primers.begin();itPrimer != primers.end(); itPrimer++){
- string primerName = primerNameVector[itPrimer->second];
- string barcodeName = barcodeNameVector[itBar->second];
-
- if ((primerName == "ignore") || (barcodeName == "ignore")) { } //do nothing
- else {
- string comboGroupName = "";
- string fileName = "";
+ if (allFiles) {
+ set<string> uniqueNames; //used to cleanup outputFileNames
+ if (pairedOligos) {
+ map<int, oligosPair> barcodes = oligos.getPairedBarcodes();
+ map<int, oligosPair> primers = oligos.getPairedPrimers();
+ for(map<int, oligosPair>::iterator itBar = barcodes.begin();itBar != barcodes.end();itBar++){
+ for(map<int, oligosPair>::iterator itPrimer = primers.begin();itPrimer != primers.end(); itPrimer++){
- map<string, string> variables;
- variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
+ string primerName = oligos.getPrimerName(itPrimer->first);
+ string barcodeName = oligos.getBarcodeName(itBar->first);
- if(primerName == ""){
- comboGroupName = barcodeNameVector[itBar->second];
- variables["[tag]"] = comboGroupName;
- fileName = getOutputFileName("flow", variables);
- }
- else{
- if(barcodeName == ""){
- comboGroupName = primerNameVector[itPrimer->second];
- }
- else{
- comboGroupName = barcodeNameVector[itBar->second] + "." + primerNameVector[itPrimer->second];
+ if ((primerName == "ignore") || (barcodeName == "ignore")) { } //do nothing
+ else if ((primerName == "") && (barcodeName == "")) { } //do nothing
+ else {
+ string comboGroupName = "";
+
+ if(primerName == ""){
+ comboGroupName = barcodeName;
+ }else{
+ if(barcodeName == ""){
+ comboGroupName = primerName;
+ }
+ else{
+ comboGroupName = barcodeName + "." + primerName;
+ }
}
+
+
+ ofstream temp;
+ map<string, string> variables;
+ variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
variables["[tag]"] = comboGroupName;
- fileName = getOutputFileName("flow", variables);
+ string fileName = getOutputFileName("flow", variables);
+ if (uniqueNames.count(fileName) == 0) {
+ outputNames.push_back(fileName);
+ outputTypes["flow"].push_back(fileName);
+ uniqueNames.insert(fileName);
+ }
+
+ outFlowFileNames[itBar->first][itPrimer->first] = fileName;
+ m->openOutputFile(fileName, temp); temp.close();
}
+ }
+ }
+ }else {
+ map<string, int> barcodes = oligos.getBarcodes() ;
+ map<string, int> primers = oligos.getPrimers();
+ for(map<string, int>::iterator itBar = barcodes.begin();itBar != barcodes.end();itBar++){
+ for(map<string, int>::iterator itPrimer = primers.begin();itPrimer != primers.end(); itPrimer++){
- outFlowFileNames[itBar->second][itPrimer->second] = fileName;
+ string primerName = oligos.getPrimerName(itPrimer->second);
+ string barcodeName = oligos.getBarcodeName(itBar->second);
- ofstream temp;
- m->openOutputFile(fileName, temp);
- temp.close();
+ if ((primerName == "ignore") || (barcodeName == "ignore")) { } //do nothing
+ else if ((primerName == "") && (barcodeName == "")) { } //do nothing
+ else {
+ string comboGroupName = "";
+
+ if(primerName == ""){
+ comboGroupName = barcodeName;
+ }else{
+ if(barcodeName == ""){
+ comboGroupName = primerName;
+ }
+ else{
+ comboGroupName = barcodeName + "." + primerName;
+ }
+ }
+
+ ofstream temp;
+ map<string, string> variables;
+ variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(flowFileName));
+ variables["[tag]"] = comboGroupName;
+ string fileName = getOutputFileName("flow", variables);
+ if (uniqueNames.count(fileName) == 0) {
+ outputNames.push_back(fileName);
+ outputTypes["flow"].push_back(fileName);
+ uniqueNames.insert(fileName);
+ }
+
+ outFlowFileNames[itBar->second][itPrimer->second] = fileName;
+ m->openOutputFile(fileName, temp); temp.close();
+ }
}
- }
- }
- }
-
- numFPrimers = primers.size();
- numRPrimers = revPrimer.size();
- numLinkers = linker.size();
- numSpacers = spacer.size();
-
- }
- catch(exception& e) {
- m->errorOut(e, "TrimSeqsCommand", "getOligos");
- exit(1);
- }
-}
-//********************************************************************/
-string TrimFlowsCommand::reverseOligo(string oligo){
- try {
- string reverse = "";
-
- for(int i=oligo.length()-1;i>=0;i--){
-
- if(oligo[i] == 'A') { reverse += 'T'; }
- else if(oligo[i] == 'T'){ reverse += 'A'; }
- else if(oligo[i] == 'U'){ reverse += 'A'; }
-
- else if(oligo[i] == 'G'){ reverse += 'C'; }
- else if(oligo[i] == 'C'){ reverse += 'G'; }
-
- else if(oligo[i] == 'R'){ reverse += 'Y'; }
- else if(oligo[i] == 'Y'){ reverse += 'R'; }
-
- else if(oligo[i] == 'M'){ reverse += 'K'; }
- else if(oligo[i] == 'K'){ reverse += 'M'; }
-
- else if(oligo[i] == 'W'){ reverse += 'W'; }
- else if(oligo[i] == 'S'){ reverse += 'S'; }
-
- else if(oligo[i] == 'B'){ reverse += 'V'; }
- else if(oligo[i] == 'V'){ reverse += 'B'; }
-
- else if(oligo[i] == 'D'){ reverse += 'H'; }
- else if(oligo[i] == 'H'){ reverse += 'D'; }
+ }
+ }
- else { reverse += 'N'; }
}
-
-
- return reverse;
- }
+ return 0;
+ }
catch(exception& e) {
- m->errorOut(e, "TrimFlowsCommand", "reverseOligo");
+ m->errorOut(e, "TrimFlowsCommand", "getOligos");
exit(1);
}
}
-
/**************************************************************************************************/
vector<unsigned long long> TrimFlowsCommand::getFlowFileBreaks() {
//loop through and create all the processes you want
while (process != processors) {
- int pid = fork();
+ pid_t pid = fork();
if (pid > 0) {
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
for(int i=0;i<tempBarcodePrimerComboFileNames.size();i++){
for(int j=0;j<tempBarcodePrimerComboFileNames[0].size();j++){
if (tempBarcodePrimerComboFileNames[i][j] != "") {
- tempBarcodePrimerComboFileNames[i][j] += toString(getpid()) + ".temp";
+ tempBarcodePrimerComboFileNames[i][j] += m->mothurGetpid(process) + ".temp";
ofstream temp;
m->openOutputFile(tempBarcodePrimerComboFileNames[i][j], temp);
temp.close();
}
}
driverCreateTrim(flowFileName,
- (trimFlowFileName + toString(getpid()) + ".temp"),
- (scrapFlowFileName + toString(getpid()) + ".temp"),
- (fastaFileName + toString(getpid()) + ".temp"),
+ (trimFlowFileName + m->mothurGetpid(process) + ".temp"),
+ (scrapFlowFileName + m->mothurGetpid(process) + ".temp"),
+ (fastaFileName + m->mothurGetpid(process) + ".temp"),
tempBarcodePrimerComboFileNames, lines[process]);
exit(0);
//Windows version shared memory, so be careful when passing variables through the trimFlowData struct.
//Above fork() will clone, so memory is separate, but that's not the case with windows,
//////////////////////////////////////////////////////////////////////////////////////////////////////
-
+ /*
vector<trimFlowData*> pDataArray;
DWORD dwThreadIdArray[processors-1];
HANDLE hThreadArray[processors-1];
CloseHandle(hThreadArray[i]);
delete pDataArray[i];
}
-
+ */
#endif
//append files