#include "chimerauchimecommand.h"
#include "deconvolutecommand.h"
-#include "uc.h"
+//#include "uc.h"
#include "sequence.hpp"
#include "referencedb.h"
-
+#include "systemcommand.h"
//**********************************************************************************************************************
vector<string> ChimeraUchimeCommand::setParameters(){
try {
CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
- CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
+ CommandParameter pname("name", "InputTypes", "", "", "NameCount", "none", "none",false,false); parameters.push_back(pname);
+ CommandParameter pcount("count", "InputTypes", "", "", "NameCount-CountGroup", "none", "none",false,false); parameters.push_back(pcount);
+ CommandParameter pgroup("group", "InputTypes", "", "", "CountGroup", "none", "none",false,false); parameters.push_back(pgroup);
CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
string helpString = "";
helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
- helpString += "The chimera.uchime command parameters are fasta, name, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
+ helpString += "The chimera.uchime command parameters are fasta, name, count, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
+ helpString += "The count parameter allows you to provide a count file, if you are using template=self. \n";
helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
+ helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
}
}
//**********************************************************************************************************************
+string ChimeraUchimeCommand::getOutputFileNameTag(string type, string inputName=""){
+ try {
+ string outputFileName = "";
+ map<string, vector<string> >::iterator it;
+
+ //is this a type this command creates
+ it = outputTypes.find(type);
+ if (it == outputTypes.end()) { m->mothurOut("[ERROR]: this command doesn't create a " + type + " output file.\n"); }
+ else {
+ if (type == "chimera") { outputFileName = "uchime.chimeras"; }
+ else if (type == "accnos") { outputFileName = "uchime.accnos"; }
+ else if (type == "alns") { outputFileName = "uchime.alns"; }
+ else { m->mothurOut("[ERROR]: No definition for type " + type + " output file tag.\n"); m->control_pressed = true; }
+ }
+ return outputFileName;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "getOutputFileNameTag");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(){
try {
abort = true; calledHelp = true;
//***************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
try {
- abort = false; calledHelp = false;
+ abort = false; calledHelp = false; hasName=false; hasCount=false;
ReferenceDB* rdb = ReferenceDB::getInstance();
//allow user to run help
//check for required parameters
- bool hasName = true;
namefile = validParameter.validFile(parameters, "name", false);
- if (namefile == "not found") { namefile = ""; hasName = false; }
+ if (namefile == "not found") { namefile = ""; }
else {
m->splitAtDash(namefile, nameFileNames);
}
}
}
+ }
+
+ if (nameFileNames.size() != 0) { hasName = true; }
+
+ //check for required parameters
+ vector<string> countfileNames;
+ countfile = validParameter.validFile(parameters, "count", false);
+ if (countfile == "not found") {
+ countfile = "";
+ }else {
+ m->splitAtDash(countfile, countfileNames);
+
+ //go through files and make sure they are good, if not, then disregard them
+ for (int i = 0; i < countfileNames.size(); i++) {
+
+ bool ignore = false;
+ if (countfileNames[i] == "current") {
+ countfileNames[i] = m->getCountTableFile();
+ if (nameFileNames[i] != "") { m->mothurOut("Using " + countfileNames[i] + " as input file for the count parameter where you had given current."); m->mothurOutEndLine(); }
+ else {
+ m->mothurOut("You have no current count file, ignoring current."); m->mothurOutEndLine(); ignore=true;
+ //erase from file list
+ countfileNames.erase(countfileNames.begin()+i);
+ i--;
+ }
+ }
+
+ if (!ignore) {
+
+ if (inputDir != "") {
+ string path = m->hasPath(countfileNames[i]);
+ //if the user has not given a path then, add inputdir. else leave path alone.
+ if (path == "") { countfileNames[i] = inputDir + countfileNames[i]; }
+ }
+
+ int ableToOpen;
+ ifstream in;
+
+ ableToOpen = m->openInputFile(countfileNames[i], in, "noerror");
+
+ //if you can't open it, try default location
+ if (ableToOpen == 1) {
+ if (m->getDefaultPath() != "") { //default path is set
+ string tryPath = m->getDefaultPath() + m->getSimpleName(countfileNames[i]);
+ m->mothurOut("Unable to open " + countfileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ countfileNames[i] = tryPath;
+ }
+ }
+
+ if (ableToOpen == 1) {
+ if (m->getOutputDir() != "") { //default path is set
+ string tryPath = m->getOutputDir() + m->getSimpleName(countfileNames[i]);
+ m->mothurOut("Unable to open " + countfileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ countfileNames[i] = tryPath;
+ }
+ }
+
+ in.close();
+
+ if (ableToOpen == 1) {
+ m->mothurOut("Unable to open " + countfileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
+ //erase from file list
+ countfileNames.erase(countfileNames.begin()+i);
+ i--;
+ }else {
+ m->setCountTableFile(countfileNames[i]);
+ }
+ }
+ }
+ }
+
+ if (countfileNames.size() != 0) { hasCount = true; }
+
+ //make sure there is at least one valid file left
+ if (hasName && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; }
+
+ if (!hasName && hasCount) { nameFileNames = countfileNames; }
+
+ if ((hasCount || hasName) && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of name or count files does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+
+ bool hasGroup = true;
+ groupfile = validParameter.validFile(parameters, "group", false);
+ if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
+ else {
+ m->splitAtDash(groupfile, groupFileNames);
+
+ //go through files and make sure they are good, if not, then disregard them
+ for (int i = 0; i < groupFileNames.size(); i++) {
+
+ bool ignore = false;
+ if (groupFileNames[i] == "current") {
+ groupFileNames[i] = m->getGroupFile();
+ if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
+ else {
+ m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }
+ }
+
+ if (!ignore) {
+
+ if (inputDir != "") {
+ string path = m->hasPath(groupFileNames[i]);
+ //if the user has not given a path then, add inputdir. else leave path alone.
+ if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
+ }
+
+ int ableToOpen;
+ ifstream in;
+
+ ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
+
+ //if you can't open it, try default location
+ if (ableToOpen == 1) {
+ if (m->getDefaultPath() != "") { //default path is set
+ string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ if (ableToOpen == 1) {
+ if (m->getOutputDir() != "") { //default path is set
+ string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ in.close();
+
+ if (ableToOpen == 1) {
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }else {
+ m->setGroupFile(groupFileNames[i]);
+ }
+ }
+ }
//make sure there is at least one valid file left
- if (nameFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid name files."); m->mothurOutEndLine(); abort = true; }
+ if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
}
- if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+ if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+
+ if (hasGroup && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or group."); m->mothurOutEndLine(); abort = true; }
+ //if the user changes the output directory command factory will send this info to us in the output parameter
+ outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
+
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
}
}
}else if (hasName) { templatefile = "self"; }
+ else if (hasCount) { templatefile = "self"; }
else {
if (rdb->getSavedReference() != "") {
templatefile = rdb->getSavedReference();
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
- convert(temp, processors);
+ m->mothurConvert(temp, processors);
abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
skipgaps2 = m->isTrue(temp);
if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
- }
+ if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
+
+ //look for uchime exe
+ path = m->argv;
+ string tempPath = path;
+ for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); }
+ path = path.substr(0, (tempPath.find_last_of('m')));
+
+ string uchimeCommand;
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+ uchimeCommand = path + "uchime"; // format the database, -o option gives us the ability
+ if (m->debug) {
+ m->mothurOut("[DEBUG]: Uchime location using \"which uchime\" = ");
+ Command* newCommand = new SystemCommand("which uchime"); m->mothurOutEndLine();
+ newCommand->execute();
+ delete newCommand;
+ m->mothurOut("[DEBUG]: Mothur's location using \"which mothur\" = ");
+ newCommand = new SystemCommand("which mothur"); m->mothurOutEndLine();
+ newCommand->execute();
+ delete newCommand;
+ }
+#else
+ uchimeCommand = path + "uchime.exe";
+#endif
+
+ //test to make sure uchime exists
+ ifstream in;
+ uchimeCommand = m->getFullPathName(uchimeCommand);
+ int ableToOpen = m->openInputFile(uchimeCommand, in, "no error"); in.close();
+ if(ableToOpen == 1) {
+ m->mothurOut(uchimeCommand + " file does not exist. Checking path... \n");
+ //check to see if uchime is in the path??
+
+ string uLocation = m->findProgramPath("uchime");
+
+
+ ifstream in2;
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+ ableToOpen = m->openInputFile(uLocation, in2, "no error"); in2.close();
+#else
+ ableToOpen = m->openInputFile((uLocation + ".exe"), in2, "no error"); in2.close();
+#endif
+
+ if(ableToOpen == 1) { m->mothurOut("[ERROR]: " + uLocation + " file does not exist. mothur requires the uchime executable."); m->mothurOutEndLine(); abort = true; }
+ else { m->mothurOut("Found uchime in your path, using " + uLocation + "\n");uchimeLocation = uLocation; }
+ }else { uchimeLocation = uchimeCommand; }
+
+ uchimeLocation = m->getFullPathName(uchimeLocation);
+ }
}
catch(exception& e) {
m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand");
int ChimeraUchimeCommand::execute(){
try{
- if (abort == true) { if (calledHelp) { return 0; } return 2; }
+
+ if (abort == true) { if (calledHelp) { return 0; } return 2; }
m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
int start = time(NULL);
string nameFile = "";
-
- if (templatefile == "self") { //you want to run uchime with a reference template
-
- #ifdef USE_MPI
- int pid;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- if (pid == 0) { //you are the root process
- #endif
+ if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
+ string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + getOutputFileNameTag("chimera");
+ string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + getOutputFileNameTag("accnos");
+ string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + getOutputFileNameTag("alns");
+ string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
+ //you provided a groupfile
+ string groupFile = "";
+ bool hasGroup = false;
+ if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; hasGroup = true; }
+ else if (hasCount) {
+ CountTable ct;
+ if (ct.testGroups(nameFileNames[s])) { hasGroup = true; }
+ }
+
+ if ((templatefile == "self") && (!hasGroup)) { //you want to run uchime with a template=self and no groups
+
if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
nameFile = nameFileNames[s];
- }else {
- m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
-
- //use unique.seqs to create new name and fastafile
- string inputString = "fasta=" + fastaFileNames[s];
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
- m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
-
- Command* uniqueCommand = new DeconvoluteCommand(inputString);
- uniqueCommand->execute();
-
- map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
-
- delete uniqueCommand;
-
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
-
- nameFile = filenames["name"][0];
- fastaFileNames[s] = filenames["fasta"][0];
- }
-
- //create input file for uchime
- //read through fastafile and store info
- map<string, string> seqs;
- ifstream in;
- m->openInputFile(fastaFileNames[s], in);
-
- while (!in.eof()) {
-
- if (m->control_pressed) { in.close(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
-
- Sequence seq(in); m->gobble(in);
- seqs[seq.getName()] = seq.getAligned();
- }
- in.close();
-
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
+
+ map<string, string> seqs;
+ readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
//read namefile
vector<seqPriorityNode> nameMapCount;
- int error = m->readNames(nameFile, nameMapCount, seqs);
-
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
-
+ int error;
+ if (hasCount) {
+ CountTable ct;
+ ct.readTable(nameFile);
+ for(map<string, string>::iterator it = seqs.begin(); it != seqs.end(); it++) {
+ int num = ct.getNumSeqs(it->first);
+ if (num == 0) { error = 1; }
+ else {
+ seqPriorityNode temp(num, it->second, it->first);
+ nameMapCount.push_back(temp);
+ }
+ }
+ }else {
+ error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ }
if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+ printFile(nameMapCount, newFasta);
+ fastaFileNames[s] = newFasta;
+ }
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ if (hasGroup) {
+ if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
+ nameFile = nameFileNames[s];
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
+
+ //Parse sequences by group
+ vector<string> groups;
+ map<string, string> uniqueNames;
+ if (hasCount) {
+ cparser = new SequenceCountParser(nameFile, fastaFileNames[s]);
+ groups = cparser->getNamesOfGroups();
+ uniqueNames = cparser->getAllSeqsMap();
+ }else{
+ sparser = new SequenceParser(groupFile, fastaFileNames[s], nameFile);
+ groups = sparser->getNamesOfGroups();
+ uniqueNames = sparser->getAllSeqsMap();
+ }
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ //clears files
+ ofstream out, out1, out2;
+ m->openOutputFile(outputFileName, out); out.close();
+ m->openOutputFile(accnosFileName, out1); out1.close();
+ if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
+ int totalSeqs = 0;
- string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
- ofstream out;
- m->openOutputFile(newFasta, out);
+ if(processors == 1) { totalSeqs = driverGroups(outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
+ else { totalSeqs = createProcessesGroups(outputFileName, newFasta, accnosFileName, alnsFileName, groups, nameFile, groupFile, fastaFileNames[s]); }
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ if (hasCount) { delete cparser; }
+ else { delete sparser; }
+
+ int totalChimeras = deconvoluteResults(uniqueNames, outputFileName, accnosFileName, alnsFileName);
- //print new file in order of
- for (int i = 0; i < nameMapCount.size(); i++) {
- out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
- }
- out.close();
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
- fastaFileNames[s] = newFasta;
-
- #ifdef USE_MPI
- }
- #endif
if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- }
-
- if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
- string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
- string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
- string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
+
+ }else{
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ int numSeqs = 0;
+ int numChimeras = 0;
+
+ if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+ else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+
+ //add headings
+ ofstream out;
+ m->openOutputFile(outputFileName+".temp", out);
+ out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n";
+ out.close();
+
+ m->appendFiles(outputFileName, outputFileName+".temp");
+ m->mothurRemove(outputFileName); rename((outputFileName+".temp").c_str(), outputFileName.c_str());
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- int numSeqs = 0;
-#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
- if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); }
- else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); }
-#else
- numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName);
-#endif
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ //remove file made for uchime
+ if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
- //remove file made for uchime
- if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ }
outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
-
- m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences."); m->mothurOutEndLine();
}
-
+
//set accnos file as new current accnosfile
string current = "";
itTypes = outputTypes.find("accnos");
}
}
//**********************************************************************************************************************
+int ChimeraUchimeCommand::deconvoluteResults(map<string, string>& uniqueNames, string outputFileName, string accnosFileName, string alnsFileName){
+ try {
+ map<string, string>::iterator itUnique;
+ int total = 0;
+
+ //edit accnos file
+ ifstream in2;
+ m->openInputFile(accnosFileName, in2);
+
+ ofstream out2;
+ m->openOutputFile(accnosFileName+".temp", out2);
+
+ string name;
+ set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
+ set<string>::iterator itNames;
+ set<string> chimerasInFile;
+ set<string>::iterator itChimeras;
+
+
+ while (!in2.eof()) {
+ if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
+
+ in2 >> name; m->gobble(in2);
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ itChimeras = chimerasInFile.find((itUnique->second));
+
+ if (itChimeras == chimerasInFile.end()) {
+ out2 << itUnique->second << endl;
+ chimerasInFile.insert((itUnique->second));
+ total++;
+ }
+ }
+ }
+ in2.close();
+ out2.close();
+
+ m->mothurRemove(accnosFileName);
+ rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
+
+
+
+ //edit chimera file
+ ifstream in;
+ m->openInputFile(outputFileName, in);
+
+ ofstream out;
+ m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
+ out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n";
+
+ float temp1;
+ string parent1, parent2, temp2, temp3, temp4, temp5, temp6, temp7, temp8, temp9, temp10, temp11, temp12, temp13, flag;
+ name = "";
+ namesInFile.clear();
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15
+ 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
+ 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
+ */
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
+
+ bool print = false;
+ in >> temp1; m->gobble(in);
+ in >> name; m->gobble(in);
+ in >> parent1; m->gobble(in);
+ in >> parent2; m->gobble(in);
+ in >> temp2 >> temp3 >> temp4 >> temp5 >> temp6 >> temp7 >> temp8 >> temp9 >> temp10 >> temp11 >> temp12 >> temp13 >> flag;
+ m->gobble(in);
+
+ //parse name - name will look like U68590/ab=1/
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ name = itUnique->second;
+ //is this name already in the file
+ itNames = namesInFile.find((name));
+
+ if (itNames == namesInFile.end()) { //no not in file
+ if (flag == "N") { //are you really a no??
+ //is this sequence really not chimeric??
+ itChimeras = chimerasInFile.find(name);
+
+ //then you really are a no so print, otherwise skip
+ if (itChimeras == chimerasInFile.end()) { print = true; }
+ }else{ print = true; }
+ }
+ }
+
+ if (print) {
+ out << temp1 << '\t' << name << restOfName << '\t';
+ namesInFile.insert(name);
+
+ //parse parent1 names
+ if (parent1 != "*") {
+ restOfName = "";
+ pos = parent1.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent1.substr(pos);
+ parent1 = parent1.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent1);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else { out << itUnique->second << restOfName << '\t'; }
+ }else { out << parent1 << '\t'; }
+
+ //parse parent2 names
+ if (parent2 != "*") {
+ restOfName = "";
+ pos = parent2.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent2.substr(pos);
+ parent2 = parent2.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent2);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else { out << itUnique->second << restOfName << '\t'; }
+ }else { out << parent2 << '\t'; }
+
+ out << temp2 << '\t' << temp3 << '\t' << temp4 << '\t' << temp5 << '\t' << temp6 << '\t' << temp7 << '\t' << temp8 << '\t' << temp9 << '\t' << temp10 << '\t' << temp11 << '\t' << temp12 << temp13 << '\t' << flag << endl;
+ }
+ }
+ in.close();
+ out.close();
+
+ m->mothurRemove(outputFileName);
+ rename((outputFileName+".temp").c_str(), outputFileName.c_str());
+
+
+ //edit anls file
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /*
+ ------------------------------------------------------------------------
+ Query ( 179 nt) F21Fcsw_11639/ab=591/
+ ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
+ ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
+
+ A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
+ Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
+ B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
+ Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
+ Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
+ Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
+ Diffs NNN N N N N N BB NNN
+ Votes 000 0 0 0 0 0 ++ 000
+ Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 159 TGGAACTGAGACACGGTCCAA 179
+ Q 159 TGGAACTGAGACACGGTCCAA 179
+ B 161 TGGAACTGAGACACGGTCCAA 181
+ Diffs
+ Votes
+ Model BBBBBBBBBBBBBBBBBBBBB
+
+ Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
+ Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
+ */
+ if (chimealns) {
+ ifstream in3;
+ m->openInputFile(alnsFileName, in3);
+
+ ofstream out3;
+ m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
+
+ name = "";
+ namesInFile.clear();
+ string line = "";
+
+ while (!in3.eof()) {
+ if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
+
+ line = "";
+ line = m->getline(in3);
+ string temp = "";
+
+ if (line != "") {
+ istringstream iss(line);
+ iss >> temp;
+
+ //are you a name line
+ if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
+ int spot = 0;
+ for (int i = 0; i < line.length(); i++) {
+ spot = i;
+ if (line[i] == ')') { break; }
+ else { out3 << line[i]; }
+ }
+
+ if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << line[spot] << line[spot+1];
+
+ name = line.substr(spot+2);
+
+ //parse name - name will either look like U68590/ab=1/ or U68590
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
+ else {
+ //only limit repeats on query names
+ if (temp == "Query") {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out << itUnique->second << restOfName << endl;
+ namesInFile.insert((itUnique->second));
+ }
+ }else { out << itUnique->second << restOfName << endl; }
+ }
+
+ }
+
+ }else { //not need to alter line
+ out3 << line << endl;
+ }
+ }else { out3 << endl; }
+ }
+ in3.close();
+ out3.close();
+
+ m->mothurRemove(alnsFileName);
+ rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
+ }
+
+ return total;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
+ try {
+
+ sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+
+ ofstream out;
+ m->openOutputFile(filename, out);
+
+ //print new file in order of
+ for (int i = 0; i < nameMapCount.size(); i++) {
+ out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
+ }
+ out.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "printFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
+ try {
+ //create input file for uchime
+ //read through fastafile and store info
+ ifstream in;
+ m->openInputFile(filename, in);
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); return 0; }
+
+ Sequence seq(in); m->gobble(in);
+ seqs[seq.getName()] = seq.getAligned();
+ }
+ in.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+
+string ChimeraUchimeCommand::getNamesFile(string& inputFile){
+ try {
+ string nameFile = "";
+
+ m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
+
+ //use unique.seqs to create new name and fastafile
+ string inputString = "fasta=" + inputFile;
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+ m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
+ m->mothurCalling = true;
+
+ Command* uniqueCommand = new DeconvoluteCommand(inputString);
+ uniqueCommand->execute();
+
+ map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
+
+ delete uniqueCommand;
+ m->mothurCalling = false;
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+
+ nameFile = filenames["name"][0];
+ inputFile = filenames["fasta"][0];
+
+ return nameFile;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::driverGroups(string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
+ try {
+
+ int totalSeqs = 0;
+ int numChimeras = 0;
+
+ for (int i = start; i < end; i++) {
+ int start = time(NULL); if (m->control_pressed) { return 0; }
+
+ int error;
+ if (hasCount) { error = cparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } }
+ else { error = sparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } }
+
+ int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
+ totalSeqs += numSeqs;
+
+ if (m->control_pressed) { return 0; }
+
+ //remove file made for uchime
+ if (!m->debug) { m->mothurRemove(filename); }
+ else { m->mothurOut("[DEBUG]: saving file: " + filename + ".\n"); }
+
+ //append files
+ m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
+ m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
+ if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
+
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
+ }
+ return totalSeqs;
+
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
-int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns){
+int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
try {
+ outputFName = m->getFullPathName(outputFName);
+ filename = m->getFullPathName(filename);
+ alns = m->getFullPathName(alns);
+
+ //to allow for spaces in the path
+ outputFName = "\"" + outputFName + "\"";
+ filename = "\"" + filename + "\"";
+ alns = "\"" + alns + "\"";
+
vector<char*> cPara;
- char* tempUchime = new char[8];
- strcpy(tempUchime, "./uchime ");
+ string uchimeCommand = uchimeLocation;
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+ uchimeCommand += " ";
+#else
+ uchimeCommand = "\"" + uchimeCommand + "\"";
+#endif
+ char* tempUchime;
+ tempUchime= new char[uchimeCommand.length()+1];
+ *tempUchime = '\0';
+ strncat(tempUchime, uchimeCommand.c_str(), uchimeCommand.length());
cPara.push_back(tempUchime);
- char* tempIn = new char[8];
- *tempIn = '\0'; strncat(tempIn, "--input", 7);
- //strcpy(tempIn, "--input");
- cPara.push_back(tempIn);
- char* temp = new char[filename.length()+1];
- *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
- //strcpy(temp, filename.c_str());
- cPara.push_back(temp);
-
- //are you using a reference file
+ //are you using a reference file
if (templatefile != "self") {
+ string outputFileName = filename.substr(1, filename.length()-2) + ".uchime_formatted";
+ prepFile(filename.substr(1, filename.length()-2), outputFileName);
+ filename = outputFileName;
+ filename = "\"" + filename + "\"";
//add reference file
char* tempRef = new char[5];
//strcpy(tempRef, "--db");
cPara.push_back(tempR);
}
+ char* tempIn = new char[8];
+ *tempIn = '\0'; strncat(tempIn, "--input", 7);
+ //strcpy(tempIn, "--input");
+ cPara.push_back(tempIn);
+ char* temp = new char[filename.length()+1];
+ *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
+ //strcpy(temp, filename.c_str());
+ cPara.push_back(temp);
+
char* tempO = new char[12];
*tempO = '\0'; strncat(tempO, "--uchimeout", 11);
//strcpy(tempO, "--uchimeout");
char** uchimeParameters;
uchimeParameters = new char*[cPara.size()];
- for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; }
- int numArgs = cPara.size();
+ string commandString = "";
+ for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; commandString += toString(cPara[i]) + " "; }
+ //int numArgs = cPara.size();
- uchime_main(numArgs, uchimeParameters);
+ //uchime_main(numArgs, uchimeParameters);
+ //cout << "commandString = " << commandString << endl;
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+#else
+ commandString = "\"" + commandString + "\"";
+#endif
+ if (m->debug) { m->mothurOut("[DEBUG]: uchime command = " + commandString + ".\n"); }
+ system(commandString.c_str());
//free memory
- for(int i = 0; i < cPara.size(); i++) { delete[] cPara[i]; }
+ for(int i = 0; i < cPara.size(); i++) { delete cPara[i]; }
delete[] uchimeParameters;
+ //remove "" from filenames
+ outputFName = outputFName.substr(1, outputFName.length()-2);
+ filename = filename.substr(1, filename.length()-2);
+ alns = alns.substr(1, alns.length()-2);
+
if (m->control_pressed) { return 0; }
//create accnos file from uchime results
m->openOutputFile(accnos, out);
int num = 0;
+ numChimeras = 0;
while(!in.eof()) {
if (m->control_pressed) { break; }
for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
m->gobble(in);
- if (chimeraFlag == "Y") { out << name << endl; }
+ if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
num++;
}
in.close();
out.close();
+ //if (templatefile != "self") { m->mothurRemove(filename); }
+
return num;
}
catch(exception& e) {
}
}
/**************************************************************************************************/
+//uchime can't handle some of the things allowed in mothurs fasta files. This functions "cleans up" the file.
+int ChimeraUchimeCommand::prepFile(string filename, string output) {
+ try {
+
+ ifstream in;
+ m->openInputFile(filename, in);
+
+ ofstream out;
+ m->openOutputFile(output, out);
+
+ while (!in.eof()) {
+ if (m->control_pressed) { break; }
+
+ Sequence seq(in); m->gobble(in);
+
+ if (seq.getName() != "") { seq.printSequence(out); }
+ }
+ in.close();
+ out.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "prepFile");
+ exit(1);
+ }
+}
+/**************************************************************************************************/
-int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns) {
+int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
try {
processIDS.clear();
int process = 1;
int num = 0;
-#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
- //break up file into multiple files
vector<string> files;
+
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+ //break up file into multiple files
m->divideFile(filename, processors, files);
if (m->control_pressed) { return 0; }
-
-#ifdef USE_MPI
- int pid, numSeqsPerProcessor;
- int tag = 2001;
-
- MPI_Status status;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- MPI_Comm_size(MPI_COMM_WORLD, &processors);
-
- if (pid == 0) { //you are the root process
- num = driver(outputFileName, files[0], accnos, alns);
-
- if (templatefile != "self") {
- //wait on chidren
- for(int j = 1; j < processors; j++) {
- int temp;
- MPI_Recv(&temp, 1, MPI_INT, j, tag, MPI_COMM_WORLD, &status);
- num += temp;
-
- m->appendFiles((outputFileName + toString(j) + ".temp"), outputFileName);
- m->mothurRemove((outputFileName + toString(j) + ".temp"));
-
- m->appendFiles((accnos + toString(j) + ".temp"), accnos);
- m->mothurRemove((accnos + toString(j) + ".temp"));
-
- if (chimealns) {
- m->appendFiles((alns + toString(j) + ".temp"), alns);
- m->mothurRemove((alns + toString(j) + ".temp"));
- }
- }
- }
- }else{ //you are a child process
- if (templatefile != "self") { //if template=self we can only use 1 processor
- num = driver(outputFileName+toString(pid) + ".temp", files[pid], accnos+toString(pid) + ".temp", alns+toString(pid) + ".temp");
- //send numSeqs to parent
- MPI_Send(&num, 1, MPI_INT, 0, tag, MPI_COMM_WORLD);
- }
- }
-
- MPI_Barrier(MPI_COMM_WORLD); //make everyone wait - just in case
-#else
-
//loop through and create all the processes you want
while (process != processors) {
int pid = fork();
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
- num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp");
+ num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
//pass numSeqs to parent
ofstream out;
string tempFile = outputFileName + toString(getpid()) + ".num.temp";
m->openOutputFile(tempFile, out);
out << num << endl;
+ out << numChimeras << endl;
out.close();
exit(0);
}
//do my part
- num = driver(outputFileName, files[0], accnos, alns);
+ num = driver(outputFileName, files[0], accnos, alns, numChimeras);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
ifstream in;
string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
m->openInputFile(tempFile, in);
- if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
+ if (!in.eof()) {
+ int tempNum = 0;
+ in >> tempNum; m->gobble(in);
+ num += tempNum;
+ in >> tempNum;
+ numChimeras += tempNum;
+ }
in.close(); m->mothurRemove(tempFile);
}
+#else
+ //////////////////////////////////////////////////////////////////////////////////////////////////////
+ //Windows version shared memory, so be careful when passing variables through the preClusterData struct.
+ //Above fork() will clone, so memory is separate, but that's not the case with windows,
+ //////////////////////////////////////////////////////////////////////////////////////////////////////
+
+ //divide file
+ int count = 0;
+ int spot = 0;
+ map<int, ofstream*> filehandles;
+ map<int, ofstream*>::iterator it3;
+
+ ofstream* temp;
+ for (int i = 0; i < processors; i++) {
+ temp = new ofstream;
+ filehandles[i] = temp;
+ m->openOutputFile(filename+toString(i)+".temp", *(temp));
+ files.push_back(filename+toString(i)+".temp");
+ }
+
+ ifstream in;
+ m->openInputFile(filename, in);
+
+ while(!in.eof()) {
+
+ if (m->control_pressed) { in.close(); for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) { (*(it3->second)).close(); delete it3->second; } return 0; }
+
+ Sequence tempSeq(in); m->gobble(in);
+
+ if (tempSeq.getName() != "") {
+ tempSeq.printSequence(*(filehandles[spot]));
+ spot++; count++;
+ if (spot == processors) { spot = 0; }
+ }
+ }
+ in.close();
+
+ //delete memory
+ for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) {
+ (*(it3->second)).close();
+ delete it3->second;
+ }
+
+ //sanity check for number of processors
+ if (count < processors) { processors = count; }
+
+ vector<uchimeData*> pDataArray;
+ DWORD dwThreadIdArray[processors-1];
+ HANDLE hThreadArray[processors-1];
+ vector<string> dummy; //used so that we can use the same struct for MyUchimeSeqsThreadFunction and MyUchimeThreadFunction
+
+ //Create processor worker threads.
+ for( int i=1; i<processors; i++ ){
+ // Allocate memory for thread data.
+ string extension = toString(i) + ".temp";
+
+ uchimeData* tempUchime = new uchimeData(outputFileName+extension, uchimeLocation, templatefile, files[i], "", "", "", accnos+extension, alns+extension, dummy, m, 0, 0, i);
+ tempUchime->setBooleans(useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount);
+ tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract);
+
+ pDataArray.push_back(tempUchime);
+ processIDS.push_back(i);
+
+ //MySeqSumThreadFunction is in header. It must be global or static to work with the threads.
+ //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
+ hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeSeqsThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
+ }
+
+
+ //using the main process as a worker saves time and memory
+ num = driver(outputFileName, files[0], accnos, alns, numChimeras);
+
+ //Wait until all threads have terminated.
+ WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
+ //Close all thread handles and free memory allocations.
+ for(int i=0; i < pDataArray.size(); i++){
+ num += pDataArray[i]->count;
+ numChimeras += pDataArray[i]->numChimeras;
+ CloseHandle(hThreadArray[i]);
+ delete pDataArray[i];
+ }
+#endif
//append output files
- for(int i=0;i<processIDS[i];i++){
+ for(int i=0;i<processIDS.size();i++){
m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
}
}
-#endif
+
//get rid of the file pieces.
for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
-#endif
return num;
}
catch(exception& e) {
exit(1);
}
}
+/**************************************************************************************************/
+int ChimeraUchimeCommand::createProcessesGroups(string outputFName, string filename, string accnos, string alns, vector<string> groups, string nameFile, string groupFile, string fastaFile) {
+ try {
+
+ processIDS.clear();
+ int process = 1;
+ int num = 0;
+
+ //sanity check
+ if (groups.size() < processors) { processors = groups.size(); }
+
+ //divide the groups between the processors
+ vector<linePair> lines;
+ int numGroupsPerProcessor = groups.size() / processors;
+ for (int i = 0; i < processors; i++) {
+ int startIndex = i * numGroupsPerProcessor;
+ int endIndex = (i+1) * numGroupsPerProcessor;
+ if(i == (processors - 1)){ endIndex = groups.size(); }
+ lines.push_back(linePair(startIndex, endIndex));
+ }
+
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix)
+
+ //loop through and create all the processes you want
+ while (process != processors) {
+ int pid = fork();
+
+ if (pid > 0) {
+ processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
+ process++;
+ }else if (pid == 0){
+ num = driverGroups(outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
+
+ //pass numSeqs to parent
+ ofstream out;
+ string tempFile = outputFName + toString(getpid()) + ".num.temp";
+ m->openOutputFile(tempFile, out);
+ out << num << endl;
+ out.close();
+
+ exit(0);
+ }else {
+ m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
+ for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
+ exit(0);
+ }
+ }
+
+ //do my part
+ num = driverGroups(outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
+
+ //force parent to wait until all the processes are done
+ for (int i=0;i<processIDS.size();i++) {
+ int temp = processIDS[i];
+ wait(&temp);
+ }
+
+ for (int i = 0; i < processIDS.size(); i++) {
+ ifstream in;
+ string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
+ m->openInputFile(tempFile, in);
+ if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
+ in.close(); m->mothurRemove(tempFile);
+ }
+
+#else
+ //////////////////////////////////////////////////////////////////////////////////////////////////////
+ //Windows version shared memory, so be careful when passing variables through the uchimeData struct.
+ //Above fork() will clone, so memory is separate, but that's not the case with windows,
+ //////////////////////////////////////////////////////////////////////////////////////////////////////
+
+ vector<uchimeData*> pDataArray;
+ DWORD dwThreadIdArray[processors-1];
+ HANDLE hThreadArray[processors-1];
+
+ //Create processor worker threads.
+ for( int i=1; i<processors; i++ ){
+ // Allocate memory for thread data.
+ string extension = toString(i) + ".temp";
+
+ uchimeData* tempUchime = new uchimeData(outputFName+extension, uchimeLocation, templatefile, filename+extension, fastaFile, nameFile, groupFile, accnos+extension, alns+extension, groups, m, lines[i].start, lines[i].end, i);
+ tempUchime->setBooleans(useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount);
+ tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract);
+
+ pDataArray.push_back(tempUchime);
+ processIDS.push_back(i);
+
+ //MyUchimeThreadFunction is in header. It must be global or static to work with the threads.
+ //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier
+ hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]);
+ }
+
+
+ //using the main process as a worker saves time and memory
+ num = driverGroups(outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
+
+ //Wait until all threads have terminated.
+ WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE);
+
+ //Close all thread handles and free memory allocations.
+ for(int i=0; i < pDataArray.size(); i++){
+ num += pDataArray[i]->count;
+ CloseHandle(hThreadArray[i]);
+ delete pDataArray[i];
+ }
+#endif
+
+
+ //append output files
+ for(int i=0;i<processIDS.size();i++){
+ m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
+ m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
+
+ m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
+ m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
+
+ if (chimealns) {
+ m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
+ m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
+ }
+ }
+
+ return num;
+
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
+ exit(1);
+ }
+}
/**************************************************************************************************/