#include "deconvolutecommand.h"
#include "uc.h"
#include "sequence.hpp"
+#include "referencedb.h"
//**********************************************************************************************************************
CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
+ CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup);
CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
CommandParameter pchunks("chunks", "Number", "", "4", "", "", "",false,false); parameters.push_back(pchunks);
CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "",false,false); parameters.push_back(pminchunk);
CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "",false,false); parameters.push_back(pidsmoothwindow);
- CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
+ //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "",false,false); parameters.push_back(pmaxp);
CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps);
CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps2);
CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "",false,false); parameters.push_back(pmaxlen);
CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pucl);
CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pqueryfract);
-
+
vector<string> myArray;
for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
return myArray;
helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
+ helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
- helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
+ //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
//***************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
try {
- abort = false; calledHelp = false;
+ abort = false; calledHelp = false;
+ ReferenceDB* rdb = ReferenceDB::getInstance();
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+ bool hasGroup = true;
+ groupfile = validParameter.validFile(parameters, "group", false);
+ if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
+ else {
+ m->splitAtDash(groupfile, groupFileNames);
+
+ //go through files and make sure they are good, if not, then disregard them
+ for (int i = 0; i < groupFileNames.size(); i++) {
+
+ bool ignore = false;
+ if (groupFileNames[i] == "current") {
+ groupFileNames[i] = m->getGroupFile();
+ if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
+ else {
+ m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }
+ }
+
+ if (!ignore) {
+
+ if (inputDir != "") {
+ string path = m->hasPath(groupFileNames[i]);
+ //if the user has not given a path then, add inputdir. else leave path alone.
+ if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
+ }
+
+ int ableToOpen;
+ ifstream in;
+
+ ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
+
+ //if you can't open it, try default location
+ if (ableToOpen == 1) {
+ if (m->getDefaultPath() != "") { //default path is set
+ string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ if (ableToOpen == 1) {
+ if (m->getOutputDir() != "") { //default path is set
+ string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ in.close();
+
+ if (ableToOpen == 1) {
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }else {
+ m->setGroupFile(groupFileNames[i]);
+ }
+ }
+ }
+
+ //make sure there is at least one valid file left
+ if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
+ }
+
+ if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+
+
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
-
string path;
it = parameters.find("reference");
//user has given a template file
templatefile = validParameter.validFile(parameters, "reference", true);
if (templatefile == "not open") { abort = true; }
- else if (templatefile == "not found") { templatefile = ""; m->mothurOut("reference is a required parameter for the chimera.uchime command."); m->mothurOutEndLine(); abort = true; }
+ else if (templatefile == "not found") { //check for saved reference sequences
+ if (rdb->getSavedReference() != "") {
+ templatefile = rdb->getSavedReference();
+ m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
+ }else {
+ m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
+ m->mothurOutEndLine();
+ abort = true;
+ }
+ }
}
}else if (hasName) { templatefile = "self"; }
- else { templatefile = ""; m->mothurOut("reference is a required parameter for the chimera.uchime command, unless you have a namefile."); m->mothurOutEndLine(); abort = true; }
-
-
+ else {
+ if (rdb->getSavedReference() != "") {
+ templatefile = rdb->getSavedReference();
+ m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
+ }else {
+ m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
+ m->mothurOutEndLine();
+ templatefile = ""; abort = true;
+ }
+ }
+
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
convert(temp, processors);
chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
- minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
+ //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
skipgaps2 = m->isTrue(temp);
+
+ if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
+ if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
}
}
int start = time(NULL);
string nameFile = "";
-
- if (templatefile == "self") { //you want to run uchime with a refernce template
-
- #ifdef USE_MPI
- int pid;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- if (pid == 0) { //you are the root process
- #endif
+ if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
+ string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
+ string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
+ string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
+ string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
+ //you provided a groupfile
+ string groupFile = "";
+ if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; }
+
+ if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template
+
if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
nameFile = nameFileNames[s];
- }else {
- m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
-
- //use unique.seqs to create new name and fastafile
- string inputString = "fasta=" + fastaFileNames[s];
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
- m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
-
- Command* uniqueCommand = new DeconvoluteCommand(inputString);
- uniqueCommand->execute();
-
- map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
-
- delete uniqueCommand;
-
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
-
- nameFile = filenames["name"][0];
- fastaFileNames[s] = filenames["fasta"][0];
- }
-
- //create input file for uchime
- //read through fastafile and store info
- map<string, string> seqs;
- ifstream in;
- m->openInputFile(fastaFileNames[s], in);
-
- while (!in.eof()) {
-
- if (m->control_pressed) { in.close(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
-
- Sequence seq(in); m->gobble(in);
- seqs[seq.getName()] = seq.getAligned();
- }
- in.close();
-
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
+
+ map<string, string> seqs;
+ readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
//read namefile
vector<seqPriorityNode> nameMapCount;
- int error = m->readNames(nameFile, nameMapCount, seqs);
-
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
- if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ printFile(nameMapCount, newFasta);
+ fastaFileNames[s] = newFasta;
+ }
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ if (groupFile != "") {
+ if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
+ nameFile = nameFileNames[s];
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
- sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+ //Parse sequences by group
+ SequenceParser parser(groupFile, fastaFileNames[s], nameFile);
+ vector<string> groups = parser.getNamesOfGroups();
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ //clears files
+ ofstream out, out1, out2;
+ m->openOutputFile(outputFileName, out); out.close();
+ m->openOutputFile(accnosFileName, out1); out1.close();
+ if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
+ int totalSeqs = 0;
- string newFasta = fastaFileNames[s] + ".temp";
- ofstream out;
- m->openOutputFile(newFasta, out);
+ #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+ if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
+ else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); }
+ #else
+ totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups);
+ #endif
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName);
- //print new file in order of
- for (int i = 0; i < nameMapCount.size(); i++) {
- out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
- }
- out.close();
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
- fastaFileNames[s] = newFasta;
-
- #ifdef USE_MPI
- }
- #endif
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
- }
-
- if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
- string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
- string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
- string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ }else{
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ int numSeqs = 0;
+ int numChimeras = 0;
+ #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+ if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+ else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+ #else
+ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras);
+ #endif
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- int numSeqs = 0;
-#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
- if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); }
- else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); }
-#else
- numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName);
-#endif
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ //remove file made for uchime
+ if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
- //remove file made for uchime
- if (templatefile == "self") { remove(fastaFileNames[s].c_str()); }
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ }
outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
-
- m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences."); m->mothurOutEndLine();
}
-
+
//set accnos file as new current accnosfile
string current = "";
itTypes = outputTypes.find("accnos");
}
}
//**********************************************************************************************************************
+int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){
+ try {
+ map<string, string> uniqueNames = parser.getAllSeqsMap();
+ map<string, string>::iterator itUnique;
+ int total = 0;
+
+ //edit chimera file
+ ifstream in;
+ m->openInputFile(outputFileName, in);
+
+ ofstream out;
+ m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
+
+ float temp1;
+ string name, rest, parent1, parent2;
+ set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
+ set<string>::iterator itNames;
+
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /*
+ 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
+ 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
+ */
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
+
+ in >> temp1; m->gobble(in);
+ in >> name; m->gobble(in);
+ in >> parent1; m->gobble(in);
+ in >> parent2; m->gobble(in);
+ rest = m->getline(in); m->gobble(in);
+
+ //parse name - name will look like U68590/ab=1/
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out << temp1 << '\t' << itUnique->second << restOfName << '\t';
+ namesInFile.insert((itUnique->second));
+
+ //parse parent1 names
+ if (parent1 != "*") {
+ restOfName = "";
+ pos = parent1.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent1.substr(pos);
+ parent1 = parent1.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent1);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << itUnique->second << restOfName << '\t';
+ }
+ }else { out << parent1 << '\t'; }
+
+ //parse parent2 names
+ if (parent2 != "*") {
+ restOfName = "";
+ pos = parent2.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent2.substr(pos);
+ parent2 = parent2.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent2);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << itUnique->second << restOfName << '\t';
+ }
+ }else { out << parent2 << '\t'; }
+
+ out << rest << endl;
+ }
+ }
+ }
+ in.close();
+ out.close();
+
+ m->mothurRemove(outputFileName);
+ rename((outputFileName+".temp").c_str(), outputFileName.c_str());
+
+ //edit accnos file
+ ifstream in2;
+ m->openInputFile(accnosFileName, in2);
+
+ ofstream out2;
+ m->openOutputFile(accnosFileName+".temp", out2);
+
+ name = "";
+ namesInFile.clear();
+
+ while (!in2.eof()) {
+ if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
+
+ in2 >> name; m->gobble(in2);
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out2 << itUnique->second << endl;
+ namesInFile.insert((itUnique->second));
+ total++;
+ }
+ }
+ }
+ in2.close();
+ out2.close();
+
+ m->mothurRemove(accnosFileName);
+ rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
+
+ //edit anls file
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /*
+ ------------------------------------------------------------------------
+ Query ( 179 nt) F21Fcsw_11639/ab=591/
+ ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
+ ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
+
+ A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
+ Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
+ B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
+ Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
+ Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
+ Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
+ Diffs NNN N N N N N BB NNN
+ Votes 000 0 0 0 0 0 ++ 000
+ Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 159 TGGAACTGAGACACGGTCCAA 179
+ Q 159 TGGAACTGAGACACGGTCCAA 179
+ B 161 TGGAACTGAGACACGGTCCAA 181
+ Diffs
+ Votes
+ Model BBBBBBBBBBBBBBBBBBBBB
+
+ Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
+ Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
+ */
+ if (chimealns) {
+ ifstream in3;
+ m->openInputFile(alnsFileName, in3);
+
+ ofstream out3;
+ m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
+
+ name = "";
+ namesInFile.clear();
+ string line = "";
+
+ while (!in3.eof()) {
+ if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
+
+ line = "";
+ line = m->getline(in3);
+ string temp = "";
+
+ if (line != "") {
+ istringstream iss(line);
+ iss >> temp;
+
+ //are you a name line
+ if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
+ int spot = 0;
+ for (int i = 0; i < line.length(); i++) {
+ spot = i;
+ if (line[i] == ')') { break; }
+ else { out3 << line[i]; }
+ }
+
+ if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << line[spot] << line[spot+1];
+
+ name = line.substr(spot+2);
+
+ //parse name - name will either look like U68590/ab=1/ or U68590
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
+ else {
+ //only limit repeats on query names
+ if (temp == "Query") {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out << itUnique->second << restOfName << endl;
+ namesInFile.insert((itUnique->second));
+ }
+ }else { out << itUnique->second << restOfName << endl; }
+ }
+
+ }
+
+ }else { //not need to alter line
+ out3 << line << endl;
+ }
+ }else { out3 << endl; }
+ }
+ in3.close();
+ out3.close();
+
+ m->mothurRemove(alnsFileName);
+ rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
+ }
+
+ return total;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
+ try {
+
+ sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+
+ ofstream out;
+ m->openOutputFile(filename, out);
+
+ //print new file in order of
+ for (int i = 0; i < nameMapCount.size(); i++) {
+ out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
+ }
+ out.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "printFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
+ try {
+ //create input file for uchime
+ //read through fastafile and store info
+ ifstream in;
+ m->openInputFile(filename, in);
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); return 0; }
+
+ Sequence seq(in); m->gobble(in);
+ seqs[seq.getName()] = seq.getAligned();
+ }
+ in.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
-int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns){
+string ChimeraUchimeCommand::getNamesFile(string& inputFile){
+ try {
+ string nameFile = "";
+
+ m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
+
+ //use unique.seqs to create new name and fastafile
+ string inputString = "fasta=" + inputFile;
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+ m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
+
+ Command* uniqueCommand = new DeconvoluteCommand(inputString);
+ uniqueCommand->execute();
+
+ map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
+
+ delete uniqueCommand;
+
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+
+ nameFile = filenames["name"][0];
+ inputFile = filenames["fasta"][0];
+
+ return nameFile;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
+ try {
+
+ int totalSeqs = 0;
+ int numChimeras = 0;
+
+ for (int i = start; i < end; i++) {
+ int start = time(NULL); if (m->control_pressed) { return 0; }
+
+ int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; }
+
+ int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
+ totalSeqs += numSeqs;
+
+ if (m->control_pressed) { return 0; }
+
+ //remove file made for uchime
+ m->mothurRemove(filename);
+
+ //append files
+ m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
+ m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
+ if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
+
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
+ }
+
+ return totalSeqs;
+
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+
+int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
try {
vector<char*> cPara;
strcpy(tempUchime, "./uchime ");
cPara.push_back(tempUchime);
- char* tempIn = new char[7];
- strcpy(tempIn, "--input");
+ char* tempIn = new char[8];
+ *tempIn = '\0'; strncat(tempIn, "--input", 7);
+ //strcpy(tempIn, "--input");
cPara.push_back(tempIn);
- char* temp = new char[filename.length()];
- strcpy(temp, filename.c_str());
+ char* temp = new char[filename.length()+1];
+ *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
+ //strcpy(temp, filename.c_str());
cPara.push_back(temp);
//are you using a reference file
if (templatefile != "self") {
-
//add reference file
- char* tempRef = new char[4];
- strcpy(tempRef, "--db");
+ char* tempRef = new char[5];
+ //strcpy(tempRef, "--db");
+ *tempRef = '\0'; strncat(tempRef, "--db", 4);
cPara.push_back(tempRef);
- char* tempR = new char[templatefile.length()];
- strcpy(tempR, templatefile.c_str());
+ char* tempR = new char[templatefile.length()+1];
+ //strcpy(tempR, templatefile.c_str());
+ *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
cPara.push_back(tempR);
}
- char* tempO = new char[11];
- strcpy(tempO, "--uchimeout");
+ char* tempO = new char[12];
+ *tempO = '\0'; strncat(tempO, "--uchimeout", 11);
+ //strcpy(tempO, "--uchimeout");
cPara.push_back(tempO);
- char* tempout = new char[outputFName.length()];
- strcpy(tempout, outputFName.c_str());
+ char* tempout = new char[outputFName.length()+1];
+ //strcpy(tempout, outputFName.c_str());
+ *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
cPara.push_back(tempout);
if (chimealns) {
- char* tempA = new char[12];
- strcpy(tempA, "--uchimealns");
+ char* tempA = new char[13];
+ *tempA = '\0'; strncat(tempA, "--uchimealns", 12);
+ //strcpy(tempA, "--uchimealns");
cPara.push_back(tempA);
- char* tempa = new char[alns.length()];
- strcpy(tempa, alns.c_str());
+ char* tempa = new char[alns.length()+1];
+ //strcpy(tempa, alns.c_str());
+ *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
cPara.push_back(tempa);
}
if (useAbskew) {
- char* tempskew = new char[8];
- strcpy(tempskew, "--abskew");
+ char* tempskew = new char[9];
+ *tempskew = '\0'; strncat(tempskew, "--abskew", 8);
+ //strcpy(tempskew, "--abskew");
cPara.push_back(tempskew);
- char* tempSkew = new char[abskew.length()];
- strcpy(tempSkew, abskew.c_str());
+ char* tempSkew = new char[abskew.length()+1];
+ //strcpy(tempSkew, abskew.c_str());
+ *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
cPara.push_back(tempSkew);
}
if (useMinH) {
- char* tempminh = new char[6];
- strcpy(tempminh, "--minh");
+ char* tempminh = new char[7];
+ *tempminh = '\0'; strncat(tempminh, "--minh", 6);
+ //strcpy(tempminh, "--minh");
cPara.push_back(tempminh);
- char* tempMinH = new char[minh.length()];
- strcpy(tempMinH, minh.c_str());
+ char* tempMinH = new char[minh.length()+1];
+ *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
+ //strcpy(tempMinH, minh.c_str());
cPara.push_back(tempMinH);
}
if (useMindiv) {
- char* tempmindiv = new char[8];
- strcpy(tempmindiv, "--mindiv");
+ char* tempmindiv = new char[9];
+ *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
+ //strcpy(tempmindiv, "--mindiv");
cPara.push_back(tempmindiv);
- char* tempMindiv = new char[mindiv.length()];
- strcpy(tempMindiv, mindiv.c_str());
+ char* tempMindiv = new char[mindiv.length()+1];
+ *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
+ //strcpy(tempMindiv, mindiv.c_str());
cPara.push_back(tempMindiv);
}
if (useXn) {
- char* tempxn = new char[4];
- strcpy(tempxn, "--xn");
+ char* tempxn = new char[5];
+ //strcpy(tempxn, "--xn");
+ *tempxn = '\0'; strncat(tempxn, "--xn", 4);
cPara.push_back(tempxn);
- char* tempXn = new char[xn.length()];
- strcpy(tempXn, xn.c_str());
+ char* tempXn = new char[xn.length()+1];
+ //strcpy(tempXn, xn.c_str());
+ *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
cPara.push_back(tempXn);
}
if (useDn) {
- char* tempdn = new char[4];
- strcpy(tempdn, "--dn");
+ char* tempdn = new char[5];
+ //strcpy(tempdn, "--dn");
+ *tempdn = '\0'; strncat(tempdn, "--dn", 4);
cPara.push_back(tempdn);
- char* tempDn = new char[dn.length()];
- strcpy(tempDn, dn.c_str());
+ char* tempDn = new char[dn.length()+1];
+ *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
+ //strcpy(tempDn, dn.c_str());
cPara.push_back(tempDn);
}
if (useXa) {
- char* tempxa = new char[4];
- strcpy(tempxa, "--xa");
+ char* tempxa = new char[5];
+ //strcpy(tempxa, "--xa");
+ *tempxa = '\0'; strncat(tempxa, "--xa", 4);
cPara.push_back(tempxa);
- char* tempXa = new char[xa.length()];
- strcpy(tempXa, xa.c_str());
+ char* tempXa = new char[xa.length()+1];
+ *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
+ //strcpy(tempXa, xa.c_str());
cPara.push_back(tempXa);
}
if (useChunks) {
- char* tempchunks = new char[8];
- strcpy(tempchunks, "--chunks");
+ char* tempchunks = new char[9];
+ //strcpy(tempchunks, "--chunks");
+ *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
cPara.push_back(tempchunks);
- char* tempChunks = new char[chunks.length()];
- strcpy(tempChunks, chunks.c_str());
+ char* tempChunks = new char[chunks.length()+1];
+ *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
+ //strcpy(tempChunks, chunks.c_str());
cPara.push_back(tempChunks);
}
if (useMinchunk) {
- char* tempminchunk = new char[10];
- strcpy(tempminchunk, "--minchunk");
+ char* tempminchunk = new char[11];
+ //strcpy(tempminchunk, "--minchunk");
+ *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
cPara.push_back(tempminchunk);
- char* tempMinchunk = new char[minchunk.length()];
- strcpy(tempMinchunk, minchunk.c_str());
+ char* tempMinchunk = new char[minchunk.length()+1];
+ *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
+ //strcpy(tempMinchunk, minchunk.c_str());
cPara.push_back(tempMinchunk);
}
if (useIdsmoothwindow) {
- char* tempidsmoothwindow = new char[16];
- strcpy(tempidsmoothwindow, "--idsmoothwindow");
+ char* tempidsmoothwindow = new char[17];
+ *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
+ //strcpy(tempidsmoothwindow, "--idsmoothwindow");
cPara.push_back(tempidsmoothwindow);
- char* tempIdsmoothwindow = new char[idsmoothwindow.length()];
- strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
+ char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
+ *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
+ //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
cPara.push_back(tempIdsmoothwindow);
}
- if (useMinsmoothid) {
- char* tempminsmoothid = new char[13];
- strcpy(tempminsmoothid, "--minsmoothid");
+ /*if (useMinsmoothid) {
+ char* tempminsmoothid = new char[14];
+ //strcpy(tempminsmoothid, "--minsmoothid");
+ *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
cPara.push_back(tempminsmoothid);
- char* tempMinsmoothid = new char[minsmoothid.length()];
- strcpy(tempMinsmoothid, minsmoothid.c_str());
+ char* tempMinsmoothid = new char[minsmoothid.length()+1];
+ *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
+ //strcpy(tempMinsmoothid, minsmoothid.c_str());
cPara.push_back(tempMinsmoothid);
- }
+ }*/
if (useMaxp) {
- char* tempmaxp = new char[6];
- strcpy(tempmaxp, "--maxp");
+ char* tempmaxp = new char[7];
+ //strcpy(tempmaxp, "--maxp");
+ *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
cPara.push_back(tempmaxp);
- char* tempMaxp = new char[maxp.length()];
- strcpy(tempMaxp, maxp.c_str());
+ char* tempMaxp = new char[maxp.length()+1];
+ *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
+ //strcpy(tempMaxp, maxp.c_str());
cPara.push_back(tempMaxp);
}
if (!skipgaps) {
- char* tempskipgaps = new char[14];
- strcpy(tempskipgaps, "--[no]skipgaps");
+ char* tempskipgaps = new char[13];
+ //strcpy(tempskipgaps, "--[no]skipgaps");
+ *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
cPara.push_back(tempskipgaps);
}
if (!skipgaps2) {
- char* tempskipgaps2 = new char[15];
- strcpy(tempskipgaps2, "--[no]skipgaps2");
+ char* tempskipgaps2 = new char[14];
+ //strcpy(tempskipgaps2, "--[no]skipgaps2");
+ *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
cPara.push_back(tempskipgaps2);
}
if (useMinlen) {
- char* tempminlen = new char[8];
- strcpy(tempminlen, "--minlen");
+ char* tempminlen = new char[9];
+ *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
+ //strcpy(tempminlen, "--minlen");
cPara.push_back(tempminlen);
- char* tempMinlen = new char[minlen.length()];
- strcpy(tempMinlen, minlen.c_str());
+ char* tempMinlen = new char[minlen.length()+1];
+ //strcpy(tempMinlen, minlen.c_str());
+ *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
cPara.push_back(tempMinlen);
}
if (useMaxlen) {
- char* tempmaxlen = new char[8];
- strcpy(tempmaxlen, "--maxlen");
+ char* tempmaxlen = new char[9];
+ //strcpy(tempmaxlen, "--maxlen");
+ *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
cPara.push_back(tempmaxlen);
- char* tempMaxlen = new char[maxlen.length()];
- strcpy(tempMaxlen, maxlen.c_str());
+ char* tempMaxlen = new char[maxlen.length()+1];
+ *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
+ //strcpy(tempMaxlen, maxlen.c_str());
cPara.push_back(tempMaxlen);
}
}
if (useQueryfract) {
- char* tempqueryfract = new char[12];
- strcpy(tempqueryfract, "--queryfract");
+ char* tempqueryfract = new char[13];
+ *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
+ //strcpy(tempqueryfract, "--queryfract");
cPara.push_back(tempqueryfract);
- char* tempQueryfract = new char[queryfract.length()];
- strcpy(tempQueryfract, queryfract.c_str());
+ char* tempQueryfract = new char[queryfract.length()+1];
+ *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
+ //strcpy(tempQueryfract, queryfract.c_str());
cPara.push_back(tempQueryfract);
}
m->openOutputFile(accnos, out);
int num = 0;
+ numChimeras = 0;
while(!in.eof()) {
if (m->control_pressed) { break; }
for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
m->gobble(in);
- if (chimeraFlag == "Y") { out << name << endl; }
+ if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
num++;
}
in.close();
}
/**************************************************************************************************/
-int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns) {
+int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
try {
processIDS.clear();
m->divideFile(filename, processors, files);
if (m->control_pressed) { return 0; }
-
-#ifdef USE_MPI
- int pid, numSeqsPerProcessor;
- int tag = 2001;
-
- MPI_Status status;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- MPI_Comm_size(MPI_COMM_WORLD, &processors);
-
- if (pid == 0) { //you are the root process
- num = driver(outputFileName, files[0], accnos, alns);
-
- if (templatefile != "self") {
- //wait on chidren
- for(int j = 1; j < processors; j++) {
- int temp;
- MPI_Recv(&temp, 1, MPI_INT, j, tag, MPI_COMM_WORLD, &status);
- num += temp;
-
- m->appendFiles((outputFileName + toString(j) + ".temp"), outputFileName);
- remove((outputFileName + toString(j) + ".temp").c_str());
-
- m->appendFiles((accnos + toString(j) + ".temp"), accnos);
- remove((accnos + toString(j) + ".temp").c_str());
-
- if (chimealns) {
- m->appendFiles((alns + toString(j) + ".temp"), alns);
- remove((alns + toString(j) + ".temp").c_str());
- }
- }
- }
- }else{ //you are a child process
- if (templatefile != "self") { //if template=self we can only use 1 processor
- num = driver(outputFileName+toString(pid) + ".temp", files[pid], accnos+toString(pid) + ".temp", alns+toString(pid) + ".temp");
- //send numSeqs to parent
- MPI_Send(&num, 1, MPI_INT, 0, tag, MPI_COMM_WORLD);
- }
- }
-
- MPI_Barrier(MPI_COMM_WORLD); //make everyone wait - just in case
-#else
-
//loop through and create all the processes you want
while (process != processors) {
int pid = fork();
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
- num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp");
+ num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
//pass numSeqs to parent
ofstream out;
string tempFile = outputFileName + toString(getpid()) + ".num.temp";
m->openOutputFile(tempFile, out);
out << num << endl;
+ out << numChimeras << endl;
out.close();
exit(0);
}
//do my part
- num = driver(outputFileName, files[0], accnos, alns);
+ num = driver(outputFileName, files[0], accnos, alns, numChimeras);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
ifstream in;
string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
m->openInputFile(tempFile, in);
- if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
- in.close(); remove(tempFile.c_str());
+ if (!in.eof()) {
+ int tempNum = 0;
+ in >> tempNum; m->gobble(in);
+ num += tempNum;
+ in >> tempNum;
+ numChimeras += tempNum;
+ }
+ in.close(); m->mothurRemove(tempFile);
}
//append output files
for(int i=0;i<processIDS[i];i++){
m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
- remove((outputFileName + toString(processIDS[i]) + ".temp").c_str());
+ m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
- remove((accnos + toString(processIDS[i]) + ".temp").c_str());
+ m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
if (chimealns) {
m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
- remove((alns + toString(processIDS[i]) + ".temp").c_str());
+ m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
}
}
-#endif
+
//get rid of the file pieces.
- for (int i = 0; i < files.size(); i++) { remove(files[i].c_str()); }
+ for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
#endif
return num;
}
exit(1);
}
}
+/**************************************************************************************************/
+int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector<string> groups) {
+ try {
+
+ processIDS.clear();
+ int process = 1;
+ int num = 0;
+
+ //sanity check
+ if (groups.size() < processors) { processors = groups.size(); }
+
+ //divide the groups between the processors
+ vector<linePair> lines;
+ int numGroupsPerProcessor = groups.size() / processors;
+ for (int i = 0; i < processors; i++) {
+ int startIndex = i * numGroupsPerProcessor;
+ int endIndex = (i+1) * numGroupsPerProcessor;
+ if(i == (processors - 1)){ endIndex = groups.size(); }
+ lines.push_back(linePair(startIndex, endIndex));
+ }
+
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+
+ //loop through and create all the processes you want
+ while (process != processors) {
+ int pid = fork();
+
+ if (pid > 0) {
+ processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
+ process++;
+ }else if (pid == 0){
+ num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
+
+ //pass numSeqs to parent
+ ofstream out;
+ string tempFile = outputFName + toString(getpid()) + ".num.temp";
+ m->openOutputFile(tempFile, out);
+ out << num << endl;
+ out.close();
+
+ exit(0);
+ }else {
+ m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
+ for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
+ exit(0);
+ }
+ }
+
+ //do my part
+ num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
+
+ //force parent to wait until all the processes are done
+ for (int i=0;i<processIDS.size();i++) {
+ int temp = processIDS[i];
+ wait(&temp);
+ }
+#endif
+
+ for (int i = 0; i < processIDS.size(); i++) {
+ ifstream in;
+ string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
+ m->openInputFile(tempFile, in);
+ if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
+ in.close(); m->mothurRemove(tempFile);
+ }
+
+
+ //append output files
+ for(int i=0;i<processIDS[i];i++){
+ m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
+ m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
+
+ m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
+ m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
+
+ if (chimealns) {
+ m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
+ m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
+ }
+ }
+
+ return num;
+
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
+ exit(1);
+ }
+}
/**************************************************************************************************/