#include "deconvolutecommand.h"
#include "uc.h"
#include "sequence.hpp"
+#include "referencedb.h"
//**********************************************************************************************************************
CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate);
CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta);
CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname);
+ CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup);
CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors);
CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir);
CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir);
-
+ CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "",false,false); parameters.push_back(pabskew);
+ CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pchimealns);
+ CommandParameter pminh("minh", "Number", "", "0.3", "", "", "",false,false); parameters.push_back(pminh);
+ CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pmindiv);
+ CommandParameter pxn("xn", "Number", "", "8.0", "", "", "",false,false); parameters.push_back(pxn);
+ CommandParameter pdn("dn", "Number", "", "1.4", "", "", "",false,false); parameters.push_back(pdn);
+ CommandParameter pxa("xa", "Number", "", "1", "", "", "",false,false); parameters.push_back(pxa);
+ CommandParameter pchunks("chunks", "Number", "", "4", "", "", "",false,false); parameters.push_back(pchunks);
+ CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "",false,false); parameters.push_back(pminchunk);
+ CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "",false,false); parameters.push_back(pidsmoothwindow);
+ //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid);
+ CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "",false,false); parameters.push_back(pmaxp);
+ CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps);
+ CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(pskipgaps2);
+ CommandParameter pminlen("minlen", "Number", "", "10", "", "", "",false,false); parameters.push_back(pminlen);
+ CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "",false,false); parameters.push_back(pmaxlen);
+ CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "",false,false); parameters.push_back(pucl);
+ CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "",false,false); parameters.push_back(pqueryfract);
+
vector<string> myArray;
for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); }
return myArray;
string helpString = "";
helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n";
helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n";
- helpString += "The chimera.uchime command parameters are fasta, name, reference and processors.\n";
+ helpString += "The chimera.uchime command parameters are fasta, name, reference, processors, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl and queryfact.\n";
helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n";
helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n";
helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n";
+ helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n";
helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n";
helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n";
+ helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n";
+ helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n";
+ helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n";
+ helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n";
+ helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n";
+ helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n";
+ helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n";
+ helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n";
+ helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n";
+ helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n";
+ //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n";
+ helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n";
+ helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n";
+ helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n";
+ helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n";
+ helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n";
+ helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n";
+ helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n";
#ifdef USE_MPI
helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n";
#endif
vector<string> tempOutNames;
outputTypes["chimera"] = tempOutNames;
outputTypes["accnos"] = tempOutNames;
+ outputTypes["alns"] = tempOutNames;
}
catch(exception& e) {
m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand");
//***************************************************************************************************************
ChimeraUchimeCommand::ChimeraUchimeCommand(string option) {
try {
- abort = false; calledHelp = false;
+ abort = false; calledHelp = false;
+ ReferenceDB* rdb = ReferenceDB::getInstance();
//allow user to run help
if(option == "help") { help(); abort = true; calledHelp = true; }
vector<string> tempOutNames;
outputTypes["chimera"] = tempOutNames;
outputTypes["accnos"] = tempOutNames;
+ outputTypes["alns"] = tempOutNames;
//if the user changes the input directory command factory will send this info to us in the output parameter
string inputDir = validParameter.validFile(parameters, "inputdir", false);
//erase from file list
fastaFileNames.erase(fastaFileNames.begin()+i);
i--;
+ }else {
+ m->setFastaFile(fastaFileNames[i]);
}
}
}
//erase from file list
nameFileNames.erase(nameFileNames.begin()+i);
i--;
+ }else {
+ m->setNameFile(nameFileNames[i]);
}
}
}
if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+ bool hasGroup = true;
+ groupfile = validParameter.validFile(parameters, "group", false);
+ if (groupfile == "not found") { groupfile = ""; hasGroup = false; }
+ else {
+ m->splitAtDash(groupfile, groupFileNames);
+
+ //go through files and make sure they are good, if not, then disregard them
+ for (int i = 0; i < groupFileNames.size(); i++) {
+
+ bool ignore = false;
+ if (groupFileNames[i] == "current") {
+ groupFileNames[i] = m->getGroupFile();
+ if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); }
+ else {
+ m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true;
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }
+ }
+
+ if (!ignore) {
+
+ if (inputDir != "") {
+ string path = m->hasPath(groupFileNames[i]);
+ //if the user has not given a path then, add inputdir. else leave path alone.
+ if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; }
+ }
+
+ int ableToOpen;
+ ifstream in;
+
+ ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror");
+
+ //if you can't open it, try default location
+ if (ableToOpen == 1) {
+ if (m->getDefaultPath() != "") { //default path is set
+ string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ if (ableToOpen == 1) {
+ if (m->getOutputDir() != "") { //default path is set
+ string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]);
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine();
+ ifstream in2;
+ ableToOpen = m->openInputFile(tryPath, in2, "noerror");
+ in2.close();
+ groupFileNames[i] = tryPath;
+ }
+ }
+
+ in.close();
+
+ if (ableToOpen == 1) {
+ m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine();
+ //erase from file list
+ groupFileNames.erase(groupFileNames.begin()+i);
+ i--;
+ }else {
+ m->setGroupFile(groupFileNames[i]);
+ }
+ }
+ }
+
+ //make sure there is at least one valid file left
+ if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; }
+ }
+
+ if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; }
+
+
//if the user changes the output directory command factory will send this info to us in the output parameter
outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; }
-
string path;
it = parameters.find("reference");
//user has given a template file
templatefile = validParameter.validFile(parameters, "reference", true);
if (templatefile == "not open") { abort = true; }
- else if (templatefile == "not found") { templatefile = ""; m->mothurOut("reference is a required parameter for the chimera.slayer command."); m->mothurOutEndLine(); abort = true; }
+ else if (templatefile == "not found") { //check for saved reference sequences
+ if (rdb->getSavedReference() != "") {
+ templatefile = rdb->getSavedReference();
+ m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
+ }else {
+ m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
+ m->mothurOutEndLine();
+ abort = true;
+ }
+ }
}
+ }else if (hasName) { templatefile = "self"; }
+ else {
+ if (rdb->getSavedReference() != "") {
+ templatefile = rdb->getSavedReference();
+ m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine();
+ }else {
+ m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required.");
+ m->mothurOutEndLine();
+ templatefile = ""; abort = true;
+ }
}
-
+
string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); }
m->setProcessors(temp);
convert(temp, processors);
+
+ abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; }
+ if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; }
+
+ temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; }
+ chimealns = m->isTrue(temp);
+
+ minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; }
+ mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; }
+ xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; }
+ dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; }
+ xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; }
+ chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; }
+ minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; }
+ idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; }
+ //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; }
+ maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; }
+ minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; }
+ maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; }
+
+ temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; }
+ ucl = m->isTrue(temp);
+
+ queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; }
+ if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; }
+
+ temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; }
+ skipgaps = m->isTrue(temp);
+
+ temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; }
+ skipgaps2 = m->isTrue(temp);
+
+ if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
+ if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; }
+
}
}
catch(exception& e) {
try{
if (abort == true) { if (calledHelp) { return 0; } return 2; }
+ m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n");
+
for (int s = 0; s < fastaFileNames.size(); s++) {
m->mothurOut("Checking sequences from " + fastaFileNames[s] + " ..." ); m->mothurOutEndLine();
int start = time(NULL);
string nameFile = "";
-
- if (templatefile == "self") { //you want to run slayer with a refernce template
-
- #ifdef USE_MPI
- int pid;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- if (pid == 0) { //you are the root process
- #endif
+ if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
+ string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera";
+ string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos";
+ string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns";
+ string newFasta = m->getRootName(fastaFileNames[s]) + "temp";
+ //you provided a groupfile
+ string groupFile = "";
+ if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; }
+
+ if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template
+
if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; }
if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
nameFile = nameFileNames[s];
- }else {
- m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
-
- //use unique.seqs to create new name and fastafile
- string inputString = "fasta=" + fastaFileNames[s];
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
- m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
-
- Command* uniqueCommand = new DeconvoluteCommand(inputString);
- uniqueCommand->execute();
-
- map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
-
- delete uniqueCommand;
-
- m->mothurOut("/******************************************/"); m->mothurOutEndLine();
-
- nameFile = filenames["name"][0];
- fastaFileNames[s] = filenames["fasta"][0];
- }
-
- //create input file for uchime
- //read through fastafile and store info
- map<string, string> seqs;
- ifstream in;
- m->openInputFile(fastaFileNames[s], in);
-
- while (!in.eof()) {
-
- if (m->control_pressed) { in.close(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
-
- Sequence seq(in); m->gobble(in);
- seqs[seq.getName()] = seq.getAligned();
- }
- in.close();
-
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
+
+ map<string, string> seqs;
+ readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
//read namefile
vector<seqPriorityNode> nameMapCount;
- int error = m->readNames(nameFile, nameMapCount, seqs);
+ int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+ if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ printFile(nameMapCount, newFasta);
+ fastaFileNames[s] = newFasta;
+ }
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ if (groupFile != "") {
+ if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one
+ nameFile = nameFileNames[s];
+ }else { nameFile = getNamesFile(fastaFileNames[s]); }
- if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
- if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ //Parse sequences by group
+ SequenceParser parser(groupFile, fastaFileNames[s], nameFile);
+ vector<string> groups = parser.getNamesOfGroups();
+
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ //clears files
+ ofstream out, out1, out2;
+ m->openOutputFile(outputFileName, out); out.close();
+ m->openOutputFile(accnosFileName, out1); out1.close();
+ if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); }
+ int totalSeqs = 0;
- sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+ #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+ if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); }
+ else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); }
+ #else
+ totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups);
+ #endif
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName);
- string newFasta = fastaFileNames[s] + ".temp";
- ofstream out;
- m->openOutputFile(newFasta, out);
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine();
- //print new file in order of
- for (int i = 0; i < nameMapCount.size(); i++) {
- out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
- }
- out.close();
-
- fastaFileNames[s] = newFasta;
-
- #ifdef USE_MPI
- }
- #endif
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
- }
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
+
+ }else{
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it
- string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "slayer.chimera";
- string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "slayer.accnos";
+ int numSeqs = 0;
+ int numChimeras = 0;
+ #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+ if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+ else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); }
+ #else
+ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras);
+ #endif
+ if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; }
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
+ //remove file made for uchime
+ if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); }
- int numSeqs = 0;
-#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
- if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName); }
- else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName); }
-#else
- numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName);
-#endif
- if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; }
-
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine();
+ }
outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName);
outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName);
-
- m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences."); m->mothurOutEndLine();
+ if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); }
}
-
+
//set accnos file as new current accnosfile
string current = "";
itTypes = outputTypes.find("accnos");
}
}
//**********************************************************************************************************************
+int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){
+ try {
+ map<string, string> uniqueNames = parser.getAllSeqsMap();
+ map<string, string>::iterator itUnique;
+ int total = 0;
+
+ //edit chimera file
+ ifstream in;
+ m->openInputFile(outputFileName, in);
+
+ ofstream out;
+ m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint);
+
+ float temp1;
+ string name, rest, parent1, parent2;
+ set<string> namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once
+ set<string>::iterator itNames;
+
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /*
+ 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N
+ 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N
+ */
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; }
+
+ in >> temp1; m->gobble(in);
+ in >> name; m->gobble(in);
+ in >> parent1; m->gobble(in);
+ in >> parent2; m->gobble(in);
+ rest = m->getline(in); m->gobble(in);
+
+ //parse name - name will look like U68590/ab=1/
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out << temp1 << '\t' << itUnique->second << restOfName << '\t';
+ namesInFile.insert((itUnique->second));
+
+ //parse parent1 names
+ if (parent1 != "*") {
+ restOfName = "";
+ pos = parent1.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent1.substr(pos);
+ parent1 = parent1.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent1);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << itUnique->second << restOfName << '\t';
+ }
+ }else { out << parent1 << '\t'; }
+
+ //parse parent2 names
+ if (parent2 != "*") {
+ restOfName = "";
+ pos = parent2.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = parent2.substr(pos);
+ parent2 = parent2.substr(0, pos);
+ }
+
+ itUnique = uniqueNames.find(parent2);
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << itUnique->second << restOfName << '\t';
+ }
+ }else { out << parent2 << '\t'; }
+
+ out << rest << endl;
+ }
+ }
+ }
+ in.close();
+ out.close();
+
+ m->mothurRemove(outputFileName);
+ rename((outputFileName+".temp").c_str(), outputFileName.c_str());
+
+ //edit accnos file
+ ifstream in2;
+ m->openInputFile(accnosFileName, in2);
+
+ ofstream out2;
+ m->openOutputFile(accnosFileName+".temp", out2);
+
+ name = "";
+ namesInFile.clear();
+
+ while (!in2.eof()) {
+ if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; }
+
+ in2 >> name; m->gobble(in2);
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out2 << itUnique->second << endl;
+ namesInFile.insert((itUnique->second));
+ total++;
+ }
+ }
+ }
+ in2.close();
+ out2.close();
+
+ m->mothurRemove(accnosFileName);
+ rename((accnosFileName+".temp").c_str(), accnosFileName.c_str());
+
+ //edit anls file
+ //assumptions - in file each read will always look like - if uchime source is updated, revisit this code.
+ /*
+ ------------------------------------------------------------------------
+ Query ( 179 nt) F21Fcsw_11639/ab=591/
+ ParentA ( 179 nt) F11Fcsw_6529/ab=1625/
+ ParentB ( 181 nt) F21Fcsw_12128/ab=1827/
+
+ A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78
+ Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78
+ B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80
+ Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN
+ Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000
+ Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158
+ B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160
+ Diffs NNN N N N N N BB NNN
+ Votes 000 0 0 0 0 0 ++ 000
+ Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+
+ A 159 TGGAACTGAGACACGGTCCAA 179
+ Q 159 TGGAACTGAGACACGGTCCAA 179
+ B 161 TGGAACTGAGACACGGTCCAA 181
+ Diffs
+ Votes
+ Model BBBBBBBBBBBBBBBBBBBBB
+
+ Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5%
+ Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047
+ */
+ if (chimealns) {
+ ifstream in3;
+ m->openInputFile(alnsFileName, in3);
+
+ ofstream out3;
+ m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint);
+
+ name = "";
+ namesInFile.clear();
+ string line = "";
+
+ while (!in3.eof()) {
+ if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; }
+
+ line = "";
+ line = m->getline(in3);
+ string temp = "";
+
+ if (line != "") {
+ istringstream iss(line);
+ iss >> temp;
+
+ //are you a name line
+ if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) {
+ int spot = 0;
+ for (int i = 0; i < line.length(); i++) {
+ spot = i;
+ if (line[i] == ')') { break; }
+ else { out3 << line[i]; }
+ }
+
+ if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; }
+ else {
+ out << line[spot] << line[spot+1];
+
+ name = line.substr(spot+2);
+
+ //parse name - name will either look like U68590/ab=1/ or U68590
+ string restOfName = "";
+ int pos = name.find_first_of('/');
+ if (pos != string::npos) {
+ restOfName = name.substr(pos);
+ name = name.substr(0, pos);
+ }
+
+ //find unique name
+ itUnique = uniqueNames.find(name);
+
+ if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; }
+ else {
+ //only limit repeats on query names
+ if (temp == "Query") {
+ itNames = namesInFile.find((itUnique->second));
+
+ if (itNames == namesInFile.end()) {
+ out << itUnique->second << restOfName << endl;
+ namesInFile.insert((itUnique->second));
+ }
+ }else { out << itUnique->second << restOfName << endl; }
+ }
+
+ }
+
+ }else { //not need to alter line
+ out3 << line << endl;
+ }
+ }else { out3 << endl; }
+ }
+ in3.close();
+ out3.close();
+
+ m->mothurRemove(alnsFileName);
+ rename((alnsFileName+".temp").c_str(), alnsFileName.c_str());
+ }
+
+ return total;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::printFile(vector<seqPriorityNode>& nameMapCount, string filename){
+ try {
+
+ sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes);
+
+ ofstream out;
+ m->openOutputFile(filename, out);
+
+ //print new file in order of
+ for (int i = 0; i < nameMapCount.size(); i++) {
+ out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl;
+ }
+ out.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "printFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::readFasta(string filename, map<string, string>& seqs){
+ try {
+ //create input file for uchime
+ //read through fastafile and store info
+ ifstream in;
+ m->openInputFile(filename, in);
+
+ while (!in.eof()) {
+
+ if (m->control_pressed) { in.close(); return 0; }
+
+ Sequence seq(in); m->gobble(in);
+ seqs[seq.getName()] = seq.getAligned();
+ }
+ in.close();
+
+ return 0;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "readFasta");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
-int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos){
+string ChimeraUchimeCommand::getNamesFile(string& inputFile){
+ try {
+ string nameFile = "";
+
+ m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine();
+
+ //use unique.seqs to create new name and fastafile
+ string inputString = "fasta=" + inputFile;
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+ m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine();
+
+ Command* uniqueCommand = new DeconvoluteCommand(inputString);
+ uniqueCommand->execute();
+
+ map<string, vector<string> > filenames = uniqueCommand->getOutputFiles();
+
+ delete uniqueCommand;
+
+ m->mothurOut("/******************************************/"); m->mothurOutEndLine();
+
+ nameFile = filenames["name"][0];
+ inputFile = filenames["fasta"][0];
+
+ return nameFile;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector<string> groups){
+ try {
+
+ int totalSeqs = 0;
+ int numChimeras = 0;
+
+ for (int i = start; i < end; i++) {
+ int start = time(NULL); if (m->control_pressed) { return 0; }
+
+ int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; }
+
+ int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras);
+ totalSeqs += numSeqs;
+
+ if (m->control_pressed) { return 0; }
+
+ //remove file made for uchime
+ m->mothurRemove(filename);
+
+ //append files
+ m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i]));
+ m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i]));
+ if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); }
+
+ m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine();
+ }
+
+ return totalSeqs;
+
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "driverGroups");
+ exit(1);
+ }
+}
+//**********************************************************************************************************************
+
+int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){
try {
vector<char*> cPara;
strcpy(tempUchime, "./uchime ");
cPara.push_back(tempUchime);
- char* tempIn = new char[7];
- strcpy(tempIn, "--input");
+ char* tempIn = new char[8];
+ *tempIn = '\0'; strncat(tempIn, "--input", 7);
+ //strcpy(tempIn, "--input");
cPara.push_back(tempIn);
- char* temp = new char[filename.length()];
- strcpy(temp, filename.c_str());
+ char* temp = new char[filename.length()+1];
+ *temp = '\0'; strncat(temp, filename.c_str(), filename.length());
+ //strcpy(temp, filename.c_str());
cPara.push_back(temp);
//are you using a reference file
if (templatefile != "self") {
-
//add reference file
- char* tempRef = new char[4];
- strcpy(tempRef, "--db");
+ char* tempRef = new char[5];
+ //strcpy(tempRef, "--db");
+ *tempRef = '\0'; strncat(tempRef, "--db", 4);
cPara.push_back(tempRef);
- char* tempR = new char[templatefile.length()];
- strcpy(tempR, templatefile.c_str());
+ char* tempR = new char[templatefile.length()+1];
+ //strcpy(tempR, templatefile.c_str());
+ *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length());
cPara.push_back(tempR);
}
- char* tempO = new char[11];
- strcpy(tempO, "--uchimeout");
+ char* tempO = new char[12];
+ *tempO = '\0'; strncat(tempO, "--uchimeout", 11);
+ //strcpy(tempO, "--uchimeout");
cPara.push_back(tempO);
- char* tempout = new char[outputFName.length()];
- strcpy(tempout, outputFName.c_str());
+ char* tempout = new char[outputFName.length()+1];
+ //strcpy(tempout, outputFName.c_str());
+ *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length());
cPara.push_back(tempout);
+ if (chimealns) {
+ char* tempA = new char[13];
+ *tempA = '\0'; strncat(tempA, "--uchimealns", 12);
+ //strcpy(tempA, "--uchimealns");
+ cPara.push_back(tempA);
+ char* tempa = new char[alns.length()+1];
+ //strcpy(tempa, alns.c_str());
+ *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length());
+ cPara.push_back(tempa);
+ }
+
+ if (useAbskew) {
+ char* tempskew = new char[9];
+ *tempskew = '\0'; strncat(tempskew, "--abskew", 8);
+ //strcpy(tempskew, "--abskew");
+ cPara.push_back(tempskew);
+ char* tempSkew = new char[abskew.length()+1];
+ //strcpy(tempSkew, abskew.c_str());
+ *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length());
+ cPara.push_back(tempSkew);
+ }
+
+ if (useMinH) {
+ char* tempminh = new char[7];
+ *tempminh = '\0'; strncat(tempminh, "--minh", 6);
+ //strcpy(tempminh, "--minh");
+ cPara.push_back(tempminh);
+ char* tempMinH = new char[minh.length()+1];
+ *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length());
+ //strcpy(tempMinH, minh.c_str());
+ cPara.push_back(tempMinH);
+ }
+
+ if (useMindiv) {
+ char* tempmindiv = new char[9];
+ *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8);
+ //strcpy(tempmindiv, "--mindiv");
+ cPara.push_back(tempmindiv);
+ char* tempMindiv = new char[mindiv.length()+1];
+ *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length());
+ //strcpy(tempMindiv, mindiv.c_str());
+ cPara.push_back(tempMindiv);
+ }
+
+ if (useXn) {
+ char* tempxn = new char[5];
+ //strcpy(tempxn, "--xn");
+ *tempxn = '\0'; strncat(tempxn, "--xn", 4);
+ cPara.push_back(tempxn);
+ char* tempXn = new char[xn.length()+1];
+ //strcpy(tempXn, xn.c_str());
+ *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length());
+ cPara.push_back(tempXn);
+ }
+
+ if (useDn) {
+ char* tempdn = new char[5];
+ //strcpy(tempdn, "--dn");
+ *tempdn = '\0'; strncat(tempdn, "--dn", 4);
+ cPara.push_back(tempdn);
+ char* tempDn = new char[dn.length()+1];
+ *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length());
+ //strcpy(tempDn, dn.c_str());
+ cPara.push_back(tempDn);
+ }
+
+ if (useXa) {
+ char* tempxa = new char[5];
+ //strcpy(tempxa, "--xa");
+ *tempxa = '\0'; strncat(tempxa, "--xa", 4);
+ cPara.push_back(tempxa);
+ char* tempXa = new char[xa.length()+1];
+ *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length());
+ //strcpy(tempXa, xa.c_str());
+ cPara.push_back(tempXa);
+ }
+
+ if (useChunks) {
+ char* tempchunks = new char[9];
+ //strcpy(tempchunks, "--chunks");
+ *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8);
+ cPara.push_back(tempchunks);
+ char* tempChunks = new char[chunks.length()+1];
+ *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length());
+ //strcpy(tempChunks, chunks.c_str());
+ cPara.push_back(tempChunks);
+ }
+
+ if (useMinchunk) {
+ char* tempminchunk = new char[11];
+ //strcpy(tempminchunk, "--minchunk");
+ *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10);
+ cPara.push_back(tempminchunk);
+ char* tempMinchunk = new char[minchunk.length()+1];
+ *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length());
+ //strcpy(tempMinchunk, minchunk.c_str());
+ cPara.push_back(tempMinchunk);
+ }
+
+ if (useIdsmoothwindow) {
+ char* tempidsmoothwindow = new char[17];
+ *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16);
+ //strcpy(tempidsmoothwindow, "--idsmoothwindow");
+ cPara.push_back(tempidsmoothwindow);
+ char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1];
+ *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length());
+ //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str());
+ cPara.push_back(tempIdsmoothwindow);
+ }
+
+ /*if (useMinsmoothid) {
+ char* tempminsmoothid = new char[14];
+ //strcpy(tempminsmoothid, "--minsmoothid");
+ *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13);
+ cPara.push_back(tempminsmoothid);
+ char* tempMinsmoothid = new char[minsmoothid.length()+1];
+ *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length());
+ //strcpy(tempMinsmoothid, minsmoothid.c_str());
+ cPara.push_back(tempMinsmoothid);
+ }*/
+
+ if (useMaxp) {
+ char* tempmaxp = new char[7];
+ //strcpy(tempmaxp, "--maxp");
+ *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6);
+ cPara.push_back(tempmaxp);
+ char* tempMaxp = new char[maxp.length()+1];
+ *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length());
+ //strcpy(tempMaxp, maxp.c_str());
+ cPara.push_back(tempMaxp);
+ }
+
+ if (!skipgaps) {
+ char* tempskipgaps = new char[13];
+ //strcpy(tempskipgaps, "--[no]skipgaps");
+ *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12);
+ cPara.push_back(tempskipgaps);
+ }
+
+ if (!skipgaps2) {
+ char* tempskipgaps2 = new char[14];
+ //strcpy(tempskipgaps2, "--[no]skipgaps2");
+ *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13);
+ cPara.push_back(tempskipgaps2);
+ }
+
+ if (useMinlen) {
+ char* tempminlen = new char[9];
+ *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8);
+ //strcpy(tempminlen, "--minlen");
+ cPara.push_back(tempminlen);
+ char* tempMinlen = new char[minlen.length()+1];
+ //strcpy(tempMinlen, minlen.c_str());
+ *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length());
+ cPara.push_back(tempMinlen);
+ }
+
+ if (useMaxlen) {
+ char* tempmaxlen = new char[9];
+ //strcpy(tempmaxlen, "--maxlen");
+ *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8);
+ cPara.push_back(tempmaxlen);
+ char* tempMaxlen = new char[maxlen.length()+1];
+ *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length());
+ //strcpy(tempMaxlen, maxlen.c_str());
+ cPara.push_back(tempMaxlen);
+ }
+
+ if (ucl) {
+ char* tempucl = new char[5];
+ strcpy(tempucl, "--ucl");
+ cPara.push_back(tempucl);
+ }
+
+ if (useQueryfract) {
+ char* tempqueryfract = new char[13];
+ *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12);
+ //strcpy(tempqueryfract, "--queryfract");
+ cPara.push_back(tempqueryfract);
+ char* tempQueryfract = new char[queryfract.length()+1];
+ *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length());
+ //strcpy(tempQueryfract, queryfract.c_str());
+ cPara.push_back(tempQueryfract);
+ }
+
+
char** uchimeParameters;
uchimeParameters = new char*[cPara.size()];
for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; }
for(int i = 0; i < cPara.size(); i++) { delete[] cPara[i]; }
delete[] uchimeParameters;
+ if (m->control_pressed) { return 0; }
+
//create accnos file from uchime results
ifstream in;
m->openInputFile(outputFName, in);
m->openOutputFile(accnos, out);
int num = 0;
+ numChimeras = 0;
while(!in.eof()) {
if (m->control_pressed) { break; }
in >> chimeraFlag >> name;
//fix name if needed
- if (templatefile != "self") {
+ if (templatefile == "self") {
name = name.substr(0, name.length()-1); //rip off last /
name = name.substr(0, name.find_last_of('/'));
}
for (int i = 0; i < 15; i++) { in >> chimeraFlag; }
m->gobble(in);
- if (chimeraFlag == "Y") { out << name << endl; }
+ if (chimeraFlag == "Y") { out << name << endl; numChimeras++; }
num++;
}
in.close();
}
/**************************************************************************************************/
-int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos) {
+int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) {
try {
processIDS.clear();
int process = 1;
int num = 0;
-
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
//break up file into multiple files
vector<string> files;
m->divideFile(filename, processors, files);
if (m->control_pressed) { return 0; }
+
+ //loop through and create all the processes you want
+ while (process != processors) {
+ int pid = fork();
+
+ if (pid > 0) {
+ processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
+ process++;
+ }else if (pid == 0){
+ num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras);
+
+ //pass numSeqs to parent
+ ofstream out;
+ string tempFile = outputFileName + toString(getpid()) + ".num.temp";
+ m->openOutputFile(tempFile, out);
+ out << num << endl;
+ out << numChimeras << endl;
+ out.close();
+
+ exit(0);
+ }else {
+ m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine();
+ for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); }
+ exit(0);
+ }
+ }
+
+ //do my part
+ num = driver(outputFileName, files[0], accnos, alns, numChimeras);
-#ifdef USE_MPI
- int pid, numSeqsPerProcessor;
- int tag = 2001;
+ //force parent to wait until all the processes are done
+ for (int i=0;i<processIDS.size();i++) {
+ int temp = processIDS[i];
+ wait(&temp);
+ }
- MPI_Status status;
- MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are
- MPI_Comm_size(MPI_COMM_WORLD, &processors);
-
- if (pid == 0) { //you are the root process
- num = driver(outputFileName, files[0], accnos);
-
- if (templatefile != "self") {
- //wait on chidren
- for(int j = 1; j < processors; j++) {
- int temp;
- MPI_Recv(&temp, 1, MPI_INT, j, tag, MPI_COMM_WORLD, &status);
- num += temp;
-
- m->appendFiles((outputFileName + toString(j) + ".temp"), outputFileName);
- remove((outputFileName + toString(j) + ".temp").c_str());
-
- m->appendFiles((accnos + toString(j) + ".temp"), accnos);
- remove((accnos + toString(j) + ".temp").c_str());
- }
+ for (int i = 0; i < processIDS.size(); i++) {
+ ifstream in;
+ string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
+ m->openInputFile(tempFile, in);
+ if (!in.eof()) {
+ int tempNum = 0;
+ in >> tempNum; m->gobble(in);
+ num += tempNum;
+ in >> tempNum;
+ numChimeras += tempNum;
}
- }else{ //you are a child process
- if (templatefile != "self") { //if template=self we can only use 1 processor
- num = driver(outputFileName+toString(pid) + ".temp", files[pid], accnos+toString(pid) + ".temp");
-
- //send numSeqs to parent
- MPI_Send(&num, 1, MPI_INT, 0, tag, MPI_COMM_WORLD);
+ in.close(); m->mothurRemove(tempFile);
+ }
+
+
+ //append output files
+ for(int i=0;i<processIDS[i];i++){
+ m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
+ m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp"));
+
+ m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
+ m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
+
+ if (chimealns) {
+ m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
+ m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
}
}
+
+ //get rid of the file pieces.
+ for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); }
+#endif
+ return num;
+ }
+ catch(exception& e) {
+ m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
+ exit(1);
+ }
+}
+/**************************************************************************************************/
- MPI_Barrier(MPI_COMM_WORLD); //make everyone wait - just in case
-#else
+int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector<string> groups) {
+ try {
+ processIDS.clear();
+ int process = 1;
+ int num = 0;
+
+ //sanity check
+ if (groups.size() < processors) { processors = groups.size(); }
+
+ //divide the groups between the processors
+ vector<linePair> lines;
+ int numGroupsPerProcessor = groups.size() / processors;
+ for (int i = 0; i < processors; i++) {
+ int startIndex = i * numGroupsPerProcessor;
+ int endIndex = (i+1) * numGroupsPerProcessor;
+ if(i == (processors - 1)){ endIndex = groups.size(); }
+ lines.push_back(linePair(startIndex, endIndex));
+ }
+
+#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux)
+
//loop through and create all the processes you want
while (process != processors) {
int pid = fork();
processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later
process++;
}else if (pid == 0){
- num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp");
+ num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups);
//pass numSeqs to parent
ofstream out;
- string tempFile = outputFileName + toString(getpid()) + ".num.temp";
+ string tempFile = outputFName + toString(getpid()) + ".num.temp";
m->openOutputFile(tempFile, out);
out << num << endl;
out.close();
}
//do my part
- num = driver(outputFileName, files[0], accnos);
+ num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups);
//force parent to wait until all the processes are done
for (int i=0;i<processIDS.size();i++) {
int temp = processIDS[i];
wait(&temp);
}
+#endif
for (int i = 0; i < processIDS.size(); i++) {
ifstream in;
- string tempFile = outputFileName + toString(processIDS[i]) + ".num.temp";
+ string tempFile = outputFName + toString(processIDS[i]) + ".num.temp";
m->openInputFile(tempFile, in);
if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; }
- in.close(); remove(tempFile.c_str());
+ in.close(); m->mothurRemove(tempFile);
}
//append output files
for(int i=0;i<processIDS[i];i++){
- m->appendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName);
- remove((outputFileName + toString(processIDS[i]) + ".temp").c_str());
+ m->appendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName);
+ m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp"));
m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos);
- remove((accnos + toString(processIDS[i]) + ".temp").c_str());
+ m->mothurRemove((accnos + toString(processIDS[i]) + ".temp"));
+
+ if (chimealns) {
+ m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns);
+ m->mothurRemove((alns + toString(processIDS[i]) + ".temp"));
+ }
}
-#endif
- //get rid of the file pieces.
- for (int i = 0; i < files.size(); i++) { remove(files[i].c_str()); }
return num;
+
}
catch(exception& e) {
- m->errorOut(e, "ChimeraUchimeCommand", "createProcesses");
+ m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups");
exit(1);
}
}
-
/**************************************************************************************************/