fixed QA_Illumina_report.rb SEQ_LEN > 20

[biopieces.git] / bp_scripts / QA_Illumina_report.rb

diff --git a/bp_scripts/QA_Illumina_report.rb b/bp_scripts/QA_Illumina_report.rb
index d7deb9244d7a3328794bdfcb1c33f310c30be71b..74d720a2c0a2e0334c8a94e799ec31d28e65af1e 100755 (executable)
--- a/bp_scripts/QA_Illumina_report.rb
+++ b/bp_scripts/QA_Illumina_report.rb
@@ -70,15 +70,15 @@ system(
    progress_meter |
    analyze_vals -k SEQ -o #{analyze_vals_file} |
    trim_seq -l 3 -m 25 |
-   grab -e 'SEQ_LEN > 0' |
+   grab -e 'SEQ_LEN > 20' |
    analyze_vals -k SEQ -o #{analyze_vals_trim_file} |
-   find_adaptor -c 12 -l 6 -L 6 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTC |
+   find_adaptor -l 6 -L 6 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTC |
    clip_adaptor |
    grab -e 'SEQ_LEN > 0' |
    analyze_vals -k SEQ -o #{analyze_vals_trim_noadapt_file} |
    plot_distribution -k SEQ_LEN -T 'Sequence length distribution' -X 'Sequence length' -t png -o #{lendist_file} |
    plot_scores -c -t png -o #{scores_file} |
-   plot_nucleotide_distribution -t png -o #{nucdist_file} |
+   plot_nucleotide_distribution -c -t png -o #{nucdist_file} |
    bin_vals -k SEQ_LEN -b 25 |
    plot_distribution -T '25 bases bin sequence length distribution' -X 'Sequence length' -k SEQ_LEN_BIN -t png -o #{lendist_bin_file} |
    mean_scores |
@@ -112,7 +112,7 @@ template = %{
       </table>
       <p>Sequence trimming was performed by removing from the ends all residues until 3 consecutive</p>
       <p>residues with quality score larger than or equal to 25.</p>
-      <p>All plots are after sequence trimming.</p>
+      <p>All plots are after sequence trimming and adaptor removal.</p>
       <h2>Sequence length distribution</h2>
       <p><img src="<%= png2base64(lendist_file) %>" width="600" /></p>
       <p><img src="<%= png2base64(lendist_bin_file) %>" width="600" /></p>