+#!/usr/bin/env ruby
+$:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
+
+# Copyright (C) 2007-2013 Martin A. Hansen.
+
+# This program is free software; you can redistribute it and/or
+# modify it under the terms of the GNU General Public License
+# as published by the Free Software Foundation; either version 2
+# of the License, or (at your option) any later version.
+
+# This program is distributed in the hope that it will be useful,
+# but WITHOUT ANY WARRANTY; without even the implied warranty of
+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
+# GNU General Public License for more details.
+
+# You should have received a copy of the GNU General Public License
+# along with this program; if not, write to the Free Software
+# Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
+
+# http://www.gnu.org/copyleft/gpl.html
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+# This software is part of the Biopieces framework (www.biopieces.org).
+
+# >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
+
+require 'test/unit'
+require 'test/helper'
+require 'maasha/seq'
+
+class HomopolymerTest < Test::Unit::TestCase
+ def setup
+ # 0 1
+ # 01234567890123456789
+ @entry = Seq.new("test", "tacgatgctagcatgcacgg")
+ @entry.extend(Homopolymer)
+ end
+
+ test "#each_homopolymer returns empty with empty sequence" do
+ @entry.seq = ""
+ assert_equal([], @entry.each_homopolymer)
+ end
+
+ test "#each_homopolymer returns empty when none found" do
+ @entry.seq = "AtTcCcGggGnnNnn"
+ assert_equal([], @entry.each_homopolymer(6))
+ end
+
+ test "#each_homopolymer returns correctly" do
+ @entry.seq = "AtTcCcGggGnnNnn"
+ assert_equal('CCC', @entry.each_homopolymer(3).first.pattern)
+ assert_equal(3, @entry.each_homopolymer(3).first.pos)
+ assert_equal(3, @entry.each_homopolymer(3).first.length)
+ end
+
+ test "#each_homopolymer in block context returns correctly" do
+ @entry.seq = "AtTcCcGggGnnNnn"
+
+ @entry.each_homopolymer(3) do |hp|
+ assert_equal('CCC', hp.pattern)
+ assert_equal(3, hp.pos)
+ assert_equal(3, hp.length)
+
+ break
+ end
+ end
+end