\name{read.dna}
\alias{read.dna}
+\alias{read.FASTA}
\title{Read DNA Sequences in a File}
+\description{
+ These functions read DNA sequences in a file, and returns a matrix or a
+ list of DNA sequences with the names of the taxa read in the file as
+ rownames or names, respectively. By default, the sequences are stored
+ in binary format, otherwise (if \code{as.character = "TRUE"}) in lower
+ case.
+}
\usage{
read.dna(file, format = "interleaved", skip = 0,
- nlines = 0, comment.char = "#", seq.names = NULL,
+ nlines = 0, comment.char = "#",
as.character = FALSE, as.matrix = NULL)
+read.FASTA(file)
}
\arguments{
\item{file}{a file name specified by either a variable of mode character,
\code{"sequential"}, \code{"clustal"}, or \code{"fasta"}, or any
unambiguous abbreviation of these.}
\item{skip}{the number of lines of the input file to skip before
- beginning to read data.}
+ beginning to read data (ignored for FASTA files; see below).}
\item{nlines}{the number of lines to be read (by default the file is
- read untill its end).}
+ read untill its end; ignored for FASTA files)).}
\item{comment.char}{a single character, the remaining of the line
- after this character is ignored.}
- \item{seq.names}{the names to give to each sequence; by default the
- names read in the file are used.}
+ after this character is ignored (ignored for FASTA files).}
\item{as.character}{a logical controlling whether to return the
sequences as an object of class \code{"DNAbin"} (the default).}
\item{as.matrix}{(used if \code{format = "fasta"}) one of the three
are of different lengths; (iii) \code{FALSE}: always returns the
sequences in a list.}
}
-\description{
- This function reads DNA sequences in a file, and returns a matrix or a
- list of DNA sequences with the names of the taxa read in the file as
- rownames or names, respectively. By default, the sequences are stored
- in binary format, otherwise (if \code{as.character = "TRUE"}) in lower
- case.
-}
\details{
- This function follows the interleaved and sequential formats defined
+ \code{read.dna} follows the interleaved and sequential formats defined
in PHYLIP (Felsenstein, 1993) but with the original feature than there
is no restriction on the lengths of the taxa names. For these two
formats, the first line of the file must contain the dimensions of the
way with blanks and line-breaks inside (with the restriction that the
first ten nucleotides must be contiguous for the interleaved and
sequential formats, see below). The names of the sequences are read in
- the file unless the `seq.names' option is used. Particularities for
- each format are detailed below.
+ the file. Particularities for each format are detailed below.
\itemize{
- \item{Interleaved:}{the function starts to read the sequences when it
- finds 10 contiguous characters belonging to the ambiguity code of
- the IUPAC (namely A, C, G, T, U, M, R, W, S, Y, K, V, H, D, B, and
- N, upper- or lowercase, so you might run into trouble if you have a
- taxa name with 10 contiguous letters among these!) All characters
- before the sequences are taken as the taxa names after removing the
- leading and trailing spaces (so spaces in a taxa name are
- allowed). It is assumed that the taxa names are not repeated in the
- subsequent blocks of nucleotides.}
+ \item{Interleaved:}{the function starts to read the sequences after it
+ finds one or more spaces (or tabulations). All characters before the
+ sequences are taken as the taxa names after removing the leading and
+ trailing spaces (so spaces in taxa names are allowed). It is assumed
+ that the taxa names are not repeated in the subsequent blocks of
+ nucleotides.}
\item{Sequential:}{the same criterion than for the interleaved format
is used to start reading the sequences and the taxa names; the
\item{FASTA:}{This looks like the sequential format but the taxa names
(or rather a description of the sequence) are on separate lines
- beginning with a `greater than' character ``>'' (there may be
+ beginning with a `greater than' character `>' (there may be
leading spaces before this character). These lines are taken as taxa
- names after removing the ``>'' and the possible leading and trailing
+ names after removing the `>' and the possible leading and trailing
spaces. All the data in the file before the first sequence is ignored.}
}}
\value{
a matrix or a list (if \code{format = "fasta"}) of DNA sequences
stored in binary format, or of mode character (if \code{as.character =
"TRUE"}).
+
+ \code{read.FASTA} always returns a list of class \code{"DNAbin"}.
}
\references{
Anonymous. FASTA format description.
file = "exdna.txt", sep = "\n")
ex.dna3 <- read.dna("exdna.txt", format = "clustal")
### ... and in FASTA format
-cat("> No305",
+cat(">No305",
"NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
-"> No304",
+">No304",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
-"> No306",
+">No306",
"ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
file = "exdna.txt", sep = "\n")
ex.dna4 <- read.dna("exdna.txt", format = "fasta")
projects / ape.git / blobdiff