From c47e480b743d1c242b8c527b6d12f992c68b8c2c Mon Sep 17 00:00:00 2001 From: westcott Date: Wed, 14 Sep 2011 17:29:48 +0000 Subject: [PATCH] adds group parameter to chimera.uchime so you can check for chimeras with template=self on a bygroup basis. --- chimerauchimecommand.cpp | 744 ++++++++++++++++++++++++++++++++------- chimerauchimecommand.h | 22 +- commandfactory.cpp | 2 +- preclustercommand.cpp | 2 + sequenceparser.cpp | 106 ++++++ sequenceparser.h | 5 + 6 files changed, 746 insertions(+), 135 deletions(-) diff --git a/chimerauchimecommand.cpp b/chimerauchimecommand.cpp index 4c1db20..73e7ace 100644 --- a/chimerauchimecommand.cpp +++ b/chimerauchimecommand.cpp @@ -20,6 +20,7 @@ vector ChimeraUchimeCommand::setParameters(){ CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate); CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta); CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname); + CommandParameter pgroup("group", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pgroup); CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors); CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir); CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir); @@ -61,6 +62,7 @@ string ChimeraUchimeCommand::getHelpString(){ helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n"; helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n"; helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n"; + helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n"; helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n"; helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n"; helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n"; @@ -299,6 +301,83 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; } + bool hasGroup = true; + groupfile = validParameter.validFile(parameters, "group", false); + if (groupfile == "not found") { groupfile = ""; hasGroup = false; } + else { + m->splitAtDash(groupfile, groupFileNames); + + //go through files and make sure they are good, if not, then disregard them + for (int i = 0; i < groupFileNames.size(); i++) { + + bool ignore = false; + if (groupFileNames[i] == "current") { + groupFileNames[i] = m->getGroupFile(); + if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); } + else { + m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true; + //erase from file list + groupFileNames.erase(groupFileNames.begin()+i); + i--; + } + } + + if (!ignore) { + + if (inputDir != "") { + string path = m->hasPath(groupFileNames[i]); + //if the user has not given a path then, add inputdir. else leave path alone. + if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; } + } + + int ableToOpen; + ifstream in; + + ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror"); + + //if you can't open it, try default location + if (ableToOpen == 1) { + if (m->getDefaultPath() != "") { //default path is set + string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]); + m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + groupFileNames[i] = tryPath; + } + } + + if (ableToOpen == 1) { + if (m->getOutputDir() != "") { //default path is set + string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]); + m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + groupFileNames[i] = tryPath; + } + } + + in.close(); + + if (ableToOpen == 1) { + m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine(); + //erase from file list + groupFileNames.erase(groupFileNames.begin()+i); + i--; + }else { + m->setGroupFile(groupFileNames[i]); + } + } + } + + //make sure there is at least one valid file left + if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; } + } + + if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; } + + //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } @@ -373,6 +452,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { skipgaps2 = m->isTrue(temp); if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; } + if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; } + } } catch(exception& e) { @@ -394,109 +475,95 @@ int ChimeraUchimeCommand::execute(){ int start = time(NULL); string nameFile = ""; - - if (templatefile == "self") { //you want to run uchime with a reference template - - #ifdef USE_MPI - int pid; - MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are - if (pid == 0) { //you are the root process - #endif + if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it + string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera"; + string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos"; + string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns"; + string newFasta = m->getRootName(fastaFileNames[s]) + "temp"; + //you provided a groupfile + string groupFile = ""; + if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; } + + if ((templatefile == "self") && (groupFile == "")) { //you want to run uchime with a reference template + if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; } if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one nameFile = nameFileNames[s]; - }else { - m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine(); - - //use unique.seqs to create new name and fastafile - string inputString = "fasta=" + fastaFileNames[s]; - m->mothurOut("/******************************************/"); m->mothurOutEndLine(); - m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine(); - - Command* uniqueCommand = new DeconvoluteCommand(inputString); - uniqueCommand->execute(); - - map > filenames = uniqueCommand->getOutputFiles(); - - delete uniqueCommand; - - m->mothurOut("/******************************************/"); m->mothurOutEndLine(); - - nameFile = filenames["name"][0]; - fastaFileNames[s] = filenames["fasta"][0]; - } - - //create input file for uchime - //read through fastafile and store info - map seqs; - ifstream in; - m->openInputFile(fastaFileNames[s], in); - - while (!in.eof()) { - - if (m->control_pressed) { in.close(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - - Sequence seq(in); m->gobble(in); - seqs[seq.getName()] = seq.getAligned(); - } - in.close(); - + }else { nameFile = getNamesFile(fastaFileNames[s]); } + + map seqs; + readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + //read namefile vector nameMapCount; - int error = m->readNames(nameFile, nameMapCount, seqs); - - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - + int error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes); + printFile(nameMapCount, newFasta); + fastaFileNames[s] = newFasta; + } + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + if (groupFile != "") { + if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one + nameFile = nameFileNames[s]; + }else { nameFile = getNamesFile(fastaFileNames[s]); } - string newFasta = m->getRootName(fastaFileNames[s]) + "temp"; - ofstream out; - m->openOutputFile(newFasta, out); + //Parse sequences by group + SequenceParser parser(groupFile, fastaFileNames[s], nameFile); + vector groups = parser.getNamesOfGroups(); + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + //clears files + ofstream out, out1, out2; + m->openOutputFile(outputFileName, out); out.close(); + m->openOutputFile(accnosFileName, out1); out1.close(); + if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); } + int totalSeqs = 0; - //print new file in order of - for (int i = 0; i < nameMapCount.size(); i++) { - out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl; - } - out.close(); + #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) + if(processors == 1) { totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); } + else { totalSeqs = createProcessesGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, groups); } + #else + totalSeqs = driverGroups(parser, outputFileName, newFasta, accnosFileName, alnsFileName, 0, groups.size(), groups); + #endif + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + int totalChimeras = deconvoluteResults(parser, outputFileName, accnosFileName, alnsFileName); + + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine(); + m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine(); - fastaFileNames[s] = newFasta; - - #ifdef USE_MPI - } - #endif if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - } - - if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it - string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.chimera"; - string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.accnos"; - string alnsFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "uchime.alns"; + + }else{ + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + int numSeqs = 0; + int numChimeras = 0; + #if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) + if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); } + else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); } + #else + numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); + #endif + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - int numSeqs = 0; -#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) - if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); } - else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); } -#else - numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName); -#endif - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + //remove file made for uchime + if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); } - //remove file made for uchime - if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); } + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine(); + } outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName); outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName); if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); } - - m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences."); m->mothurOutEndLine(); } - + //set accnos file as new current accnosfile string current = ""; itTypes = outputTypes.find("accnos"); @@ -518,8 +585,368 @@ int ChimeraUchimeCommand::execute(){ } } //********************************************************************************************************************** +int ChimeraUchimeCommand::deconvoluteResults(SequenceParser& parser, string outputFileName, string accnosFileName, string alnsFileName){ + try { + map uniqueNames = parser.getAllSeqsMap(); + map::iterator itUnique; + int total = 0; + + //edit chimera file + ifstream in; + m->openInputFile(outputFileName, in); + + ofstream out; + m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint); + + float temp1; + string name, rest, parent1, parent2; + set namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once + set::iterator itNames; + + //assumptions - in file each read will always look like - if uchime source is updated, revisit this code. + /* + 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N + 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N + */ + + while (!in.eof()) { + + if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; } + + in >> temp1; m->gobble(in); + in >> name; m->gobble(in); + in >> parent1; m->gobble(in); + in >> parent2; m->gobble(in); + rest = m->getline(in); m->gobble(in); + + //parse name - name will look like U68590/ab=1/ + string restOfName = ""; + int pos = name.find_first_of('/'); + if (pos != string::npos) { + restOfName = name.substr(pos); + name = name.substr(0, pos); + } + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + itNames = namesInFile.find((itUnique->second)); + + if (itNames == namesInFile.end()) { + out << temp1 << '\t' << itUnique->second << restOfName << '\t'; + namesInFile.insert((itUnique->second)); + + //parse parent1 names + if (parent1 != "*") { + restOfName = ""; + pos = parent1.find_first_of('/'); + if (pos != string::npos) { + restOfName = parent1.substr(pos); + parent1 = parent1.substr(0, pos); + } + + itUnique = uniqueNames.find(parent1); + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + out << itUnique->second << restOfName << '\t'; + } + }else { out << parent1 << '\t'; } + + //parse parent2 names + if (parent2 != "*") { + restOfName = ""; + pos = parent2.find_first_of('/'); + if (pos != string::npos) { + restOfName = parent2.substr(pos); + parent2 = parent2.substr(0, pos); + } + + itUnique = uniqueNames.find(parent2); + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + out << itUnique->second << restOfName << '\t'; + } + }else { out << parent2 << '\t'; } + + out << rest << endl; + } + } + } + in.close(); + out.close(); + + m->mothurRemove(outputFileName); + rename((outputFileName+".temp").c_str(), outputFileName.c_str()); + + //edit accnos file + ifstream in2; + m->openInputFile(accnosFileName, in2); + + ofstream out2; + m->openOutputFile(accnosFileName+".temp", out2); + + name = ""; + namesInFile.clear(); + + while (!in2.eof()) { + if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; } + + in2 >> name; m->gobble(in2); + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + itNames = namesInFile.find((itUnique->second)); + + if (itNames == namesInFile.end()) { + out2 << itUnique->second << endl; + namesInFile.insert((itUnique->second)); + total++; + } + } + } + in2.close(); + out2.close(); + + m->mothurRemove(accnosFileName); + rename((accnosFileName+".temp").c_str(), accnosFileName.c_str()); + + //edit anls file + //assumptions - in file each read will always look like - if uchime source is updated, revisit this code. + /* + ------------------------------------------------------------------------ + Query ( 179 nt) F21Fcsw_11639/ab=591/ + ParentA ( 179 nt) F11Fcsw_6529/ab=1625/ + ParentB ( 181 nt) F21Fcsw_12128/ab=1827/ + + A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78 + Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78 + B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80 + Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN + Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000 + Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB + + A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158 + Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158 + B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160 + Diffs NNN N N N N N BB NNN + Votes 000 0 0 0 0 0 ++ 000 + Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB + + A 159 TGGAACTGAGACACGGTCCAA 179 + Q 159 TGGAACTGAGACACGGTCCAA 179 + B 161 TGGAACTGAGACACGGTCCAA 181 + Diffs + Votes + Model BBBBBBBBBBBBBBBBBBBBB + + Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5% + Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047 + */ + if (chimealns) { + ifstream in3; + m->openInputFile(alnsFileName, in3); + + ofstream out3; + m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint); + + name = ""; + namesInFile.clear(); + string line = ""; + + while (!in3.eof()) { + if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; } + + line = ""; + line = m->getline(in3); + string temp = ""; + + if (line != "") { + istringstream iss(line); + iss >> temp; + + //are you a name line + if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) { + int spot = 0; + for (int i = 0; i < line.length(); i++) { + spot = i; + if (line[i] == ')') { break; } + else { out3 << line[i]; } + } + + if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + out << line[spot] << line[spot+1]; + + name = line.substr(spot+2); + + //parse name - name will either look like U68590/ab=1/ or U68590 + string restOfName = ""; + int pos = name.find_first_of('/'); + if (pos != string::npos) { + restOfName = name.substr(pos); + name = name.substr(0, pos); + } + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; } + else { + //only limit repeats on query names + if (temp == "Query") { + itNames = namesInFile.find((itUnique->second)); + + if (itNames == namesInFile.end()) { + out << itUnique->second << restOfName << endl; + namesInFile.insert((itUnique->second)); + } + }else { out << itUnique->second << restOfName << endl; } + } + + } + + }else { //not need to alter line + out3 << line << endl; + } + }else { out3 << endl; } + } + in3.close(); + out3.close(); + + m->mothurRemove(alnsFileName); + rename((alnsFileName+".temp").c_str(), alnsFileName.c_str()); + } + + return total; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::printFile(vector& nameMapCount, string filename){ + try { + + sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes); + + ofstream out; + m->openOutputFile(filename, out); + + //print new file in order of + for (int i = 0; i < nameMapCount.size(); i++) { + out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl; + } + out.close(); + + return 0; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "printFile"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::readFasta(string filename, map& seqs){ + try { + //create input file for uchime + //read through fastafile and store info + ifstream in; + m->openInputFile(filename, in); + + while (!in.eof()) { + + if (m->control_pressed) { in.close(); return 0; } + + Sequence seq(in); m->gobble(in); + seqs[seq.getName()] = seq.getAligned(); + } + in.close(); + + return 0; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "readFasta"); + exit(1); + } +} +//********************************************************************************************************************** -int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns){ +string ChimeraUchimeCommand::getNamesFile(string& inputFile){ + try { + string nameFile = ""; + + m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine(); + + //use unique.seqs to create new name and fastafile + string inputString = "fasta=" + inputFile; + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine(); + + Command* uniqueCommand = new DeconvoluteCommand(inputString); + uniqueCommand->execute(); + + map > filenames = uniqueCommand->getOutputFiles(); + + delete uniqueCommand; + + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + + nameFile = filenames["name"][0]; + inputFile = filenames["fasta"][0]; + + return nameFile; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::driverGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, int start, int end, vector groups){ + try { + + int totalSeqs = 0; + int numChimeras = 0; + + for (int i = start; i < end; i++) { + int start = time(NULL); if (m->control_pressed) { return 0; } + + int error = parser.getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } + + int numSeqs = driver((outputFName + groups[i]), filename, (accnos+ groups[i]), (alns+ groups[i]), numChimeras); + totalSeqs += numSeqs; + + if (m->control_pressed) { return 0; } + + //remove file made for uchime + m->mothurRemove(filename); + + //append files + m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i])); + m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i])); + if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); } + + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine(); + } + + return totalSeqs; + + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "driverGroups"); + exit(1); + } +} +//********************************************************************************************************************** + +int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){ try { vector cPara; @@ -766,6 +1193,7 @@ int ChimeraUchimeCommand::driver(string outputFName, string filename, string acc m->openOutputFile(accnos, out); int num = 0; + numChimeras = 0; while(!in.eof()) { if (m->control_pressed) { break; } @@ -783,7 +1211,7 @@ int ChimeraUchimeCommand::driver(string outputFName, string filename, string acc for (int i = 0; i < 15; i++) { in >> chimeraFlag; } m->gobble(in); - if (chimeraFlag == "Y") { out << name << endl; } + if (chimeraFlag == "Y") { out << name << endl; numChimeras++; } num++; } in.close(); @@ -798,7 +1226,7 @@ int ChimeraUchimeCommand::driver(string outputFName, string filename, string acc } /**************************************************************************************************/ -int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns) { +int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) { try { processIDS.clear(); @@ -810,49 +1238,7 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename m->divideFile(filename, processors, files); if (m->control_pressed) { return 0; } - -#ifdef USE_MPI - int pid, numSeqsPerProcessor; - int tag = 2001; - - MPI_Status status; - MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are - MPI_Comm_size(MPI_COMM_WORLD, &processors); - if (pid == 0) { //you are the root process - num = driver(outputFileName, files[0], accnos, alns); - - if (templatefile != "self") { - //wait on chidren - for(int j = 1; j < processors; j++) { - int temp; - MPI_Recv(&temp, 1, MPI_INT, j, tag, MPI_COMM_WORLD, &status); - num += temp; - - m->appendFiles((outputFileName + toString(j) + ".temp"), outputFileName); - m->mothurRemove((outputFileName + toString(j) + ".temp")); - - m->appendFiles((accnos + toString(j) + ".temp"), accnos); - m->mothurRemove((accnos + toString(j) + ".temp")); - - if (chimealns) { - m->appendFiles((alns + toString(j) + ".temp"), alns); - m->mothurRemove((alns + toString(j) + ".temp")); - } - } - } - }else{ //you are a child process - if (templatefile != "self") { //if template=self we can only use 1 processor - num = driver(outputFileName+toString(pid) + ".temp", files[pid], accnos+toString(pid) + ".temp", alns+toString(pid) + ".temp"); - - //send numSeqs to parent - MPI_Send(&num, 1, MPI_INT, 0, tag, MPI_COMM_WORLD); - } - } - - MPI_Barrier(MPI_COMM_WORLD); //make everyone wait - just in case -#else - //loop through and create all the processes you want while (process != processors) { int pid = fork(); @@ -861,13 +1247,14 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later process++; }else if (pid == 0){ - num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp"); + num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras); //pass numSeqs to parent ofstream out; string tempFile = outputFileName + toString(getpid()) + ".num.temp"; m->openOutputFile(tempFile, out); out << num << endl; + out << numChimeras << endl; out.close(); exit(0); @@ -879,7 +1266,7 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename } //do my part - num = driver(outputFileName, files[0], accnos, alns); + num = driver(outputFileName, files[0], accnos, alns, numChimeras); //force parent to wait until all the processes are done for (int i=0;iopenInputFile(tempFile, in); - if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; } + if (!in.eof()) { + int tempNum = 0; + in >> tempNum; m->gobble(in); + num += tempNum; + in >> tempNum; + numChimeras += tempNum; + } in.close(); m->mothurRemove(tempFile); } @@ -909,7 +1302,7 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename m->mothurRemove((alns + toString(processIDS[i]) + ".temp")); } } -#endif + //get rid of the file pieces. for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); } #endif @@ -920,6 +1313,95 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename exit(1); } } +/**************************************************************************************************/ +int ChimeraUchimeCommand::createProcessesGroups(SequenceParser& parser, string outputFName, string filename, string accnos, string alns, vector groups) { + try { + + processIDS.clear(); + int process = 1; + int num = 0; + + //sanity check + if (groups.size() < processors) { processors = groups.size(); } + + //divide the groups between the processors + vector lines; + int numGroupsPerProcessor = groups.size() / processors; + for (int i = 0; i < processors; i++) { + int startIndex = i * numGroupsPerProcessor; + int endIndex = (i+1) * numGroupsPerProcessor; + if(i == (processors - 1)){ endIndex = groups.size(); } + lines.push_back(linePair(startIndex, endIndex)); + } + +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) + + //loop through and create all the processes you want + while (process != processors) { + int pid = fork(); + + if (pid > 0) { + processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later + process++; + }else if (pid == 0){ + num = driverGroups(parser, outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups); + + //pass numSeqs to parent + ofstream out; + string tempFile = outputFName + toString(getpid()) + ".num.temp"; + m->openOutputFile(tempFile, out); + out << num << endl; + out.close(); + + exit(0); + }else { + m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine(); + for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); } + exit(0); + } + } + + //do my part + num = driverGroups(parser, outputFName, filename, accnos, alns, lines[0].start, lines[0].end, groups); + + //force parent to wait until all the processes are done + for (int i=0;iopenInputFile(tempFile, in); + if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; } + in.close(); m->mothurRemove(tempFile); + } + + + //append output files + for(int i=0;iappendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName); + m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp")); + + m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos); + m->mothurRemove((accnos + toString(processIDS[i]) + ".temp")); + + if (chimealns) { + m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns); + m->mothurRemove((alns + toString(processIDS[i]) + ".temp")); + } + } + + return num; + + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups"); + exit(1); + } +} /**************************************************************************************************/ diff --git a/chimerauchimecommand.h b/chimerauchimecommand.h index 8478117..1f86a98 100644 --- a/chimerauchimecommand.h +++ b/chimerauchimecommand.h @@ -13,6 +13,7 @@ #include "mothur.h" #include "command.hpp" +#include "sequenceparser.h" /***********************************************************/ @@ -33,18 +34,33 @@ public: void help() { m->mothurOut(getHelpString()); } private: + struct linePair { + int start; + int end; + linePair(int i, int j) : start(i), end(j) {} + }; + vector processIDS; //processid - int driver(string, string, string, string); - int createProcesses(string, string, string, string); + int driver(string, string, string, string, int&); + int createProcesses(string, string, string, string, int&); bool abort, useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract; - string fastafile, templatefile, outputDir, namefile, abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract; + string fastafile, groupfile, templatefile, outputDir, namefile, abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract; int processors; vector outputNames; vector fastaFileNames; vector nameFileNames; + vector groupFileNames; + string getNamesFile(string&); + int readFasta(string, map&); + int printFile(vector&, string); + int deconvoluteResults(SequenceParser&, string, string, string); + int driverGroups(SequenceParser&, string, string, string, string, int, int, vector); + int createProcessesGroups(SequenceParser&, string, string, string, string, vector); + + }; /***********************************************************/ diff --git a/commandfactory.cpp b/commandfactory.cpp index dcd811f..8e61e6e 100644 --- a/commandfactory.cpp +++ b/commandfactory.cpp @@ -256,7 +256,7 @@ CommandFactory::CommandFactory(){ commands["chimera.ccode"] = "MPIEnabled"; commands["chimera.check"] = "MPIEnabled"; commands["chimera.slayer"] = "MPIEnabled"; - commands["chimera.uchime"] = "MPIEnabled"; + commands["chimera.uchime"] = "chimera.uchime"; commands["chimera.pintail"] = "MPIEnabled"; commands["chimera.bellerophon"] = "MPIEnabled"; commands["screen.seqs"] = "MPIEnabled"; diff --git a/preclustercommand.cpp b/preclustercommand.cpp index 67b2f31..74eddbe 100644 --- a/preclustercommand.cpp +++ b/preclustercommand.cpp @@ -235,6 +235,8 @@ int PreClusterCommand::execute(){ } + delete parser; + //run unique.seqs for deconvolute results string inputString = "fasta=" + newFastaFile; if (namefile != "") { inputString += ", name=" + newNamesFile; } diff --git a/sequenceparser.cpp b/sequenceparser.cpp index 44012d8..e60f19b 100644 --- a/sequenceparser.cpp +++ b/sequenceparser.cpp @@ -106,6 +106,8 @@ SequenceParser::SequenceParser(string groupFile, string fastaFile, string nameFi } } } + + allSeqsMap[names[i]] = names[0]; } @@ -247,6 +249,78 @@ vector SequenceParser::getSeqs(string g){ exit(1); } } +/************************************************************/ +int SequenceParser::getSeqs(string g, string filename, bool uchimeFormat=false){ + try { + map >::iterator it; + vector seqForThisGroup; + vector nameVector; + + it = seqs.find(g); + if(it == seqs.end()) { + m->mothurOut("[ERROR]: No sequences available for group " + g + ", please correct."); m->mothurOutEndLine(); + }else { + + ofstream out; + m->openOutputFile(filename, out); + + seqForThisGroup = it->second; + + if (uchimeFormat) { + // format should look like + //>seqName /ab=numRedundantSeqs/ + //sequence + + map nameMapForThisGroup = getNameMap(g); + map::iterator itNameMap; + int error = 0; + + for (int i = 0; i < seqForThisGroup.size(); i++) { + itNameMap = nameMapForThisGroup.find(seqForThisGroup[i].getName()); + + if (itNameMap == nameMapForThisGroup.end()){ + error = 1; + m->mothurOut("[ERROR]: " + seqForThisGroup[i].getName() + " is in your fastafile, but is not in your namesfile, please correct."); m->mothurOutEndLine(); + }else { + int num = m->getNumNames(itNameMap->second); + + seqPriorityNode temp(num, seqForThisGroup[i].getAligned(), seqForThisGroup[i].getName()); + nameVector.push_back(temp); + } + } + + if (error == 1) { out.close(); m->mothurRemove(filename); return 1; } + + //sort by num represented + sort(nameVector.begin(), nameVector.end(), compareSeqPriorityNodes); + + //print new file in order of + for (int i = 0; i < nameVector.size(); i++) { + + if(m->control_pressed) { out.close(); m->mothurRemove(filename); return 1; } + + out << ">" << nameVector[i].name << "/ab=" << nameVector[i].numIdentical << "/" << endl << nameVector[i].seq << endl; + } + + }else { + for (int i = 0; i < seqForThisGroup.size(); i++) { + + if(m->control_pressed) { out.close(); m->mothurRemove(filename); return 1; } + + seqForThisGroup[i].printSequence(out); + } + } + out.close(); + } + + return 0; + } + catch(exception& e) { + m->errorOut(e, "SequenceParser", "getSeqs"); + exit(1); + } +} + /************************************************************/ map SequenceParser::getNameMap(string g){ try { @@ -268,6 +342,38 @@ map SequenceParser::getNameMap(string g){ } } /************************************************************/ +int SequenceParser::getNameMap(string g, string filename){ + try { + map >::iterator it; + map nameMapForThisGroup; + + it = nameMapPerGroup.find(g); + if(it == nameMapPerGroup.end()) { + m->mothurOut("[ERROR]: No nameMap available for group " + g + ", please correct."); m->mothurOutEndLine(); + }else { + nameMapForThisGroup = it->second; + + ofstream out; + m->openOutputFile(filename, out); + + for (map::iterator itFile = nameMapForThisGroup.begin(); itFile != nameMapForThisGroup.end(); itFile++) { + + if(m->control_pressed) { out.close(); m->mothurRemove(filename); return 1; } + + out << itFile->first << '\t' << itFile->second << endl; + } + + out.close(); + } + + return 0; + } + catch(exception& e) { + m->errorOut(e, "SequenceParser", "getNameMap"); + exit(1); + } +} +/************************************************************/ diff --git a/sequenceparser.h b/sequenceparser.h index fa838f0..23fcb9e 100644 --- a/sequenceparser.h +++ b/sequenceparser.h @@ -42,12 +42,17 @@ class SequenceParser { vector getSeqs(string); //returns unique sequences in a specific group map getNameMap(string); //returns seqName -> namesOfRedundantSeqs separated by commas for a specific group - the name file format, but each line is parsed by group. + int getSeqs(string, string, bool); //prints unique sequences in a specific group to a file - group, filename, uchimeFormat=false + int getNameMap(string, string); //print seqName -> namesOfRedundantSeqs separated by commas for a specific group - group, filename + + map getAllSeqsMap(){ return allSeqsMap; } //returns map where the key=sequenceName and the value=representativeSequence - helps us remove duplicates after group by group processing private: GroupMap* groupMap; MothurOut* m; int numSeqs; + map allSeqsMap; map > seqs; //a vector for each group map > nameMapPerGroup; //nameMap for each group }; -- 2.39.5