From 0a2c58a90a31d848cae583b1187ea0c713a2d046 Mon Sep 17 00:00:00 2001 From: martinahansen Date: Thu, 14 Apr 2011 14:27:47 +0000 Subject: [PATCH] updated patternmatcher code git-svn-id: http://biopieces.googlecode.com/svn/trunk@1327 74ccb610-7750-0410-82ae-013aeee3265d --- code_ruby/Maasha/lib/patternmatcher.rb | 243 ++++++++++--------- code_ruby/Maasha/lib/seq.rb | 17 +- code_ruby/Maasha/test/test_patternmatcher.rb | 197 ++++++--------- code_ruby/Maasha/test/test_seq.rb | 52 ++-- 4 files changed, 224 insertions(+), 285 deletions(-) diff --git a/code_ruby/Maasha/lib/patternmatcher.rb b/code_ruby/Maasha/lib/patternmatcher.rb index b4d92b8..478ffba 100644 --- a/code_ruby/Maasha/lib/patternmatcher.rb +++ b/code_ruby/Maasha/lib/patternmatcher.rb @@ -46,75 +46,54 @@ EQUAL = { } # Module containing code to locate nucleotide patterns in sequences allowing for -# ambiguity codes and a given maximum number of mismatches, insertions, and deletions. +# ambiguity codes and a given maximum edit distance. # Insertions are nucleotides found in the pattern but not in the sequence. # Deletions are nucleotides found in the sequence but not in the pattern. +# +# Inspired by the paper by Bruno Woltzenlogel Paleo (page 197): +# http://www.logic.at/people/bruno/Papers/2007-GATE-ESSLLI.pdf module PatternMatcher # ------------------------------------------------------------------------------ - # str.match(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]]) + # str.match(pattern[, pos[, max_edit_distance]]) # -> Match or nil # # ------------------------------------------------------------------------------ - # Method to locate the next pattern match starting from a given position. - # A match is located by exploring all possible paths allowing for a given - # maximum number of mismatches, insertions and deletions. If a match is - # located a Match object will be returned. If all paths are exhausted and - # no match is located the position is incremented. If no match is located - # whatsoever, then nil is returned. - # TODO: converging paths should be skipped for speed-up. - def match(pattern, pos = 0, max_mismatches = 0, max_insertions = 0, max_deletions = 0) - @pattern = pattern - @max_mismatches = max_mismatches - @max_insertions = max_insertions - @max_deletions = max_deletions - - while pos <= @seq.length - @pattern.length + @max_insertions - paths = [] - paths << Path.new(pos, seq_index = pos, pattern_index = 0) - - while not paths.empty? - new_paths = [] - - paths.each do |path| - next if path.exhausted?(@seq, @pattern) - return path.to_match if match_found?(path) - - if path.match?(@seq, @pattern) - new_paths << path.match - elsif path.mismatches < max_mismatches - new_paths << path.mismatch - end - - new_paths << path.insertion if path.insertions < max_insertions - new_paths << path.deletion if path.deletions < max_deletions - end + # Method to locate the next pattern match starting from a given position. A match + # is allowed to contain a given maximum edit distance. If a match is located a + # Match object will be returned otherwise nil. + def match(pattern, pos = 0, max_edit_distance = 0) + @pattern = pattern + @pos = pos + @max_edit_distance = max_edit_distance + @vector = vector_init - paths = new_paths - end + while @pos < @seq.length + vector_update + + return match_new if match_found? - pos += 1 + @pos += 1 end end # ------------------------------------------------------------------------------ - # str.scan(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]]) + # str.scan(pattern[, pos[, max_edit_distance]]) # -> Array - # str.scan(pattern[, pos[, max_mismatches[, max_insertions[, max_deletions]]]]) { |match| + # str.scan(pattern[, pos[, max_edit_distance]]) { |match| # block # } # -> Match # # ------------------------------------------------------------------------------ # Method to iterate through a sequence to locate pattern matches starting - # from a given position. A match is located by exploring all possible paths - # allowing for a given maximum number of mismatches, insertions and deletions. + # from a given position and allowing for a maximum edit distance. # Matches found in block context return the Match object. Otherwise matches are # returned in an Array. - def scan(pattern, pos = 0, max_mismatches = 0, max_insertions = 0, max_deletions = 0) + def scan(pattern, pos = 0, max_edit_distance = 0) matches = [] offset = pos - while match = match(pattern, offset, max_mismatches, max_insertions, max_deletions) + while match = match(pattern, offset, max_edit_distance) if block_given? yield match else @@ -129,99 +108,139 @@ module PatternMatcher private - # Method to check if a path is complete and a match was found. - def match_found?(path) - if path.mismatches <= @max_mismatches and path.insertions <= @max_insertions and path.deletions <= @max_deletions - if path.matches == @pattern.length - path.insertions - path.mismatches - return true - end + # Method to initailize the score vector and return this. + def vector_init + vector = [] + + (0 ... @pattern.length + 1).each do |i| + vector[i] = Score.new(matches = 0, mismatches = 0, insertions = i) end + + vector end - # Class for describing a path for matching a nucleotide sequence and a pattern. - class Path - attr_accessor :pos, :seq_index, :pattern_index, :matches, :mismatches, :insertions, :deletions, :length + # Method to update the score vector. + def vector_update + new_vector = @vector.dup - def initialize(pos, seq_index, pattern_index, matches = 0, mismatches = 0, insertions = 0, deletions = 0, length = 0) - @pos = pos - @seq_index = seq_index - @pattern_index = pattern_index - @matches = matches - @mismatches = mismatches - @insertions = insertions - @deletions = deletions - @length = length + (0 ... @pattern.length).each do |i| + if EQUAL[(@seq[@pos] + @pattern[i]).upcase.to_sym] + new_vector[i + 1] = @vector[i].dup + new_vector[i + 1].matches += 1 + else + mismatch = @vector[i].dup + insertion = new_vector[i].dup + deletion = @vector[i + 1].dup + + if deletion?(mismatch, insertion, deletion) + deletion.deletions += 1 + new_vector[i + 1] = deletion + elsif mismatch?(mismatch, insertion, deletion) + mismatch.mismatches += 1 + new_vector[i + 1] = mismatch + elsif insertion?(mismatch, insertion, deletion) + insertion.insertions += 1 + new_vector[i + 1] = insertion + else + raise "AAAAarrgh" + end + end end - # Method to check if nucleotides match. - def match?(seq, pattern) - EQUAL["#{seq[self.seq_index]}#{pattern[self.pattern_index]}".upcase.to_sym] + @vector = new_vector + end + + # Method to determine if a mismatch occured. + def mismatch?(mismatch, insertion, deletion) + if mismatch.edit_distance <= insertion.edit_distance and + mismatch.edit_distance <= deletion.edit_distance + true end + end - # Method to check if the path is exhausted. - def exhausted?(seq, pattern) - if self.seq_index - self.insertions > seq.length - true - elsif self.pattern_index > pattern.length - true - end + # Method to determine if an insertion occured. + def insertion?(mismatch, insertion, deletion) + if insertion.edit_distance <= mismatch.edit_distance and + insertion.edit_distance <= deletion.edit_distance + true + end + end + + # Method to determine if a deletion occured. + def deletion?(mismatch, insertion, deletion) + if deletion.edit_distance <= mismatch.edit_distance and + deletion.edit_distance <= insertion.edit_distance + true end + end - # Method that returns a Match object created from a Path object. - def to_match - Match.new(@pos, @matches, @mismatches, @insertions, @deletions, @length) + # Method to print the score vector. + def vector_print + @vector.each do |s| + puts s end - # Method that returns a new Match object for a matching path - def match - path_match = self.dup - path_match.length += 1 - path_match.matches += 1 - path_match.seq_index += 1 - path_match.pattern_index += 1 - path_match + puts + end + + # Method that returns a Match object initialized with + # information from the score vector. + def match_new + matches = @vector.last.matches + mismatches = @vector.last.mismatches + insertions = @vector.last.insertions + deletions = @vector.last.deletions + length = @pattern.length - insertions + deletions + pos = @pos - length + 1 + match = @seq[pos ... pos + length] + + Match.new(pos, match, matches, mismatches, insertions, deletions, length) + end + + # Method that determines if a match was found by analyzing the score vector. + def match_found? + if @vector.last.edit_distance <= @max_edit_distance + true end + end - # Method that returns a new Match object for a matching path - def mismatch - path_mismatch = self.dup - path_mismatch.length += 1 - path_mismatch.mismatches += 1 - path_mismatch.seq_index += 1 - path_mismatch.pattern_index += 1 - path_mismatch + # Class to instantiate Score objects that holds score information. + class Score + attr_accessor :matches, :mismatches, :insertions, :deletions + + def initialize(matches = 0, mismatches = 0, insertions = 0, deletions = 0) + @matches = matches + @mismatches = mismatches + @insertions = insertions + @deletions = deletions end - # Method that returns a new Match object for a insertion path - def insertion - path_insertion = self.dup - path_insertion.insertions += 1 - path_insertion.pattern_index += 1 - path_insertion + # Method to calculate and return the edit distance. + def edit_distance + self.mismatches + self.insertions + self.deletions end - # Method that returns a new Match object for a deletion path - def deletion - path_deletion = self.dup - path_deletion.length += 1 - path_deletion.deletions += 1 - path_deletion.seq_index += 1 - path_deletion + private + + def to_s + "(#{[self.matches, self.mismatches, self.insertions, self.deletions].join(',')})" end end # Class for creating Match objects which contain the description of a # match between a nucleotide sequence and a pattern. class Match - attr_reader :pos, :matches, :mismatches, :insertions, :deletions, :length + attr_reader :pos, :match, :matches, :mismatches, :insertions, :deletions, :edit_distance, :length - def initialize(pos, matches, mismatches, insertions, deletions, length) - @pos = pos - @matches = matches - @mismatches = mismatches - @insertions = insertions - @deletions = deletions - @length = length + def initialize(pos, match, matches, mismatches, insertions, deletions, length) + @pos = pos + @match = match + @matches = matches + @mismatches = mismatches + @insertions = insertions + @deletions = deletions + @edit_distance = mismatches + insertions + deletions + @length = length end end end diff --git a/code_ruby/Maasha/lib/seq.rb b/code_ruby/Maasha/lib/seq.rb index efba4ff..64dc0db 100644 --- a/code_ruby/Maasha/lib/seq.rb +++ b/code_ruby/Maasha/lib/seq.rb @@ -311,22 +311,17 @@ class Seq end # Method that finds an adaptor or part thereof in the sequence of a Seq object. - # Returns a Match object if the adaptor was found otherwise nil. The mis_percent, - # ins_percent, and del_percent indicate the maximum number of mismatches, - # insertions, and deletions allowed in all possible overlaps. - def adaptor_find(adaptor, mis_percent = 0, ins_percent = 0, del_percent = 0) - raise SeqError, "Mismatch percent out of range #{mis_percent}" unless (0 .. 100).include? mis_percent - raise SeqError, "Insertion percent out of range #{ins_percent}" unless (0 .. 100).include? ins_percent - raise SeqError, "Deletion percent out of range #{del_percent}" unless (0 .. 100).include? del_percent + # Returns a Match object if the adaptor was found otherwise nil. The ed_percent + # indicates the maximum edit distance allowed in all possible overlaps. + def adaptor_find(adaptor, ed_percent = 0) + raise SeqError, "Edit distance percent out of range #{ed_percent}" unless (0 .. 100).include? ed_percent pos = 0 while adaptor.length > 0 - mis_max = (adaptor.length * mis_percent * 0.01).round - ins_max = (adaptor.length * ins_percent * 0.01).round - del_max = (adaptor.length * del_percent * 0.01).round + ed_max = (adaptor.length * ed_percent * 0.01).round - match = self.match(adaptor, pos, mis_max, ins_max, del_max) + match = self.match(adaptor, pos, ed_max) return match unless match.nil? diff --git a/code_ruby/Maasha/test/test_patternmatcher.rb b/code_ruby/Maasha/test/test_patternmatcher.rb index 940b67a..7993862 100755 --- a/code_ruby/Maasha/test/test_patternmatcher.rb +++ b/code_ruby/Maasha/test/test_patternmatcher.rb @@ -31,157 +31,106 @@ require 'pp' class TestPatternMatcher < Test::Unit::TestCase def setup - @entry = Seq.new("test", "atcg") + @p = Seq.new("test", "atcg") end - def test_PatternMatcher_match_with_perfect_match_returns_ok - assert_equal(4, @entry.match("atcg").matches) - assert_equal(2, @entry.match("cg").matches) + def test_PatternMatcher_no_match_returns_nil + assert_nil(@p.match("gggg")) end - def test_PatternMatcher_match_with_perfect_match_with_ambiguity_returns_ok - assert_equal(4, @entry.match("aNcg").matches) + def test_PatternMatcher_match_perfect_returns_correctly + m = @p.match("atcg") + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(4, m.matches) + assert_equal(0, m.mismatches) + assert_equal(0, m.insertions) + assert_equal(0, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_fail_match_returns_nil - assert_nil(@entry.match("gggg")) + def test_PatternMatcher_match_perfect_with_ambiguity_codes_returns_correctly + m = @p.match("nnnn") + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(4, m.matches) + assert_equal(0, m.mismatches) + assert_equal(0, m.insertions) + assert_equal(0, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_one_mismatch_with_zero_allowed_returns_nil - assert_nil(@entry.match("aAcg")) + def test_PatternMatcher_match_with_one_mismatch_and_edit_dist_zero_returns_nil + assert_nil(@p.match("aCcg")) end - def test_PatternMatcher_match_with_one_mismatch_with_one_allowed_returns_ok - assert_equal(1, @entry.match("aGcg", pos = 0, mismatches = 1).mismatches) + def test_PatternMatcher_match_with_one_mismatch_and_edit_dist_one_returns_correctly + m = @p.match("aCcg", pos = 0, edit_distance = 1) + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(3, m.matches) + assert_equal(1, m.mismatches) + assert_equal(0, m.insertions) + assert_equal(0, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_two_mismatch_with_one_allowed_returns_nil - assert_nil(@entry.match("CtcA", pos = 0, mismatches = 1)) + def test_PatternMatcher_match_with_two_mismatch_and_edit_dist_one_returns_nil + assert_nil(@p.match("aGcA", pos = 0, edit_distance = 1)) end - def test_PatternMatcher_match_with_two_mismatch_with_two_allowed_returns_ok - assert_equal(2, @entry.match("CtcA", pos = 0, mismatches = 2).mismatches) + def test_PatternMatcher_match_with_one_insertion_and_edit_dist_zero_returns_nil + assert_nil(@p.match("atGcg")) end - def test_PatternMatcher_match_with_one_insertion_with_zero_allowed_returns_nil - assert_nil(@entry.match("atTcg", pos = 0, mismatches = 0, insertions = 0)) - assert_nil(@entry.match("Tatcg", pos = 0, mismatches = 0, insertions = 0)) - assert_nil(@entry.match("atcgT", pos = 0, mismatches = 0, insertions = 0)) + def test_PatternMatcher_match_with_one_insertion_and_edit_dist_one_returns_correctly + m = @p.match("atGcg", pos = 0, edit_distance = 1) + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(4, m.matches) + assert_equal(0, m.mismatches) + assert_equal(1, m.insertions) + assert_equal(0, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_one_insertion_with_one_allowed_returns_ok - assert_equal(1, @entry.match("atTcg", pos = 0, mismatches = 0, insertions = 1).insertions) + def test_PatternMatcher_match_with_two_insertions_and_edit_dist_one_returns_nil + assert_nil(@p.match("atGcTg", pos = 0, edit_distance = 1)) end - def test_PatternMatcher_match_with_two_insertion_with_one_allowed_returns_nil - assert_nil(@entry.match("aCCtcg", pos = 0, mismatches = 0, insertions = 1)) - assert_nil(@entry.match("CCatcg", pos = 0, mismatches = 0, insertions = 1)) - assert_nil(@entry.match("atcgCC", pos = 0, mismatches = 0, insertions = 1)) - assert_nil(@entry.match("CatcgC", pos = 0, mismatches = 0, insertions = 1)) + def test_PatternMatcher_match_with_two_insertions_and_edit_dist_two_returns_correctly + m = @p.match("atGcTg", pos = 0, edit_distance = 2) + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(4, m.matches) + assert_equal(0, m.mismatches) + assert_equal(2, m.insertions) + assert_equal(0, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_two_insertion_with_two_allowed_returns_ok - assert_equal(2, @entry.match("aCCtcg", pos = 0, mismatches = 0, insertions = 2).insertions) - assert_equal(2, @entry.match("CCatcg", pos = 0, mismatches = 0, insertions = 2).insertions) + def test_PatternMatcher_match_with_one_deletion_and_edit_distance_zero_returns_nil + assert_nil(@p.match("acg")) end - def test_PatternMatcher_match_with_one_deletion_with_zero_allowed_returns_nil - assert_nil(@entry.match("acg")) - assert_nil(@entry.match("atg")) + def test_PatternMatcher_match_with_one_deletion_and_edit_distance_one_returns_correctly + m = @p.match("acg", pos = 0, edit_distance = 1) + assert_equal(0, m.pos) + assert_equal("atcg", m.match) + assert_equal(3, m.matches) + assert_equal(0, m.mismatches) + assert_equal(0, m.insertions) + assert_equal(1, m.deletions) + assert_equal(4, m.length) end - def test_PatternMatcher_match_with_one_deletion_with_one_allowed_returns_ok - assert_equal(1, @entry.match("tcg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions) - assert_equal(1, @entry.match("acg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions) - assert_equal(1, @entry.match("atg", pos = 0, mismatchses = 0, insertions = 0, deletions = 1).deletions) + def test_PatternMatcher_scan_locates_three_patterns_ok + p = Seq.new("test", "ataacgagctagctagctagctgactac") + assert_equal(3, p.scan("tag").count) end - # atcg - # axdd - # g x - def test_PatternMatcher_match_with_two_deletion_with_one_allowed_returns_nil - assert_nil(@entry.match("ag", pos = 0, mismatchses = 0, insertions = 0, deletions = 1)) - end - - def test_PatternMatcher_match_with_two_deletion_with_two_allowed_returns_ok - assert_equal(2, @entry.match("cg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions) - assert_equal(2, @entry.match("tg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions) - assert_equal(2, @entry.match("ag", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions) - end - - def test_PatternMatcher_match_with_one_mismatch_one_insertions_one_deletion_returns_ok - assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).mismatches) - assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).insertions) - assert_equal(1, @entry.match("ggtg", pos = 0, mismatchses = 1, insertions = 1, deletions = 1).deletions) - end - - # atcgagctagctagctagctgactac - # ax - # t x - # g i - # g i - # c x - # g x - # - # at--cg - # || || - # atggcg - def test_PatternMatcher_match_with_two_insertions_and_two_allowed_returns_ok - entry = Seq.new("test", "atcgagctagctagctagctgactac") - assert_equal(2, entry.match("atggcg", pos = 0, mismatchses = 0, insertions = 2, deletions = 0).insertions) - end - - # atggcgagctagctagctagctgactac - # ax - # t xdd - # c x - # g x - # - # atggcg - # || || - # at--cg - def test_PatternMatcher_match_with_two_deletions_and_two_allowed_returns_ok - entry = Seq.new("test", "atggcgagctagctagctagctgactac") - assert_equal(2, entry.match("atcg", pos = 0, mismatchses = 0, insertions = 0, deletions = 2).deletions) - end - - # ataacgagctagctagctagctgactac - # ax - # gi - # t xdd - # c x - # g x - # - # a-taacg - # | | || - # agt--cg - def test_PatternMatcher_match_with_one_insertions_and_two_deletions_all_allowed_returns_ok - entry = Seq.new("test", "ataacgagctagctagctagctgactac") - assert_equal(1, entry.match("agtcg", pos = 0, mismatchses = 0, insertions = 1, deletions = 2).insertions) - assert_equal(2, entry.match("agtcg", pos = 0, mismatchses = 0, insertions = 1, deletions = 2).deletions) - end - - # --atcg - # || - # cgat - def test_PatternMatcher_match_overlapping_left_end_returns_ok - assert_equal(2, @entry.match("cgat", pos = 0, mismatches = 0, insertions = 2, deletions = 0).insertions) - end - - # atcg - # || - # --cgag - def test_PatternMatcher_match_overlapping_right_end_returns_ok - assert_equal(2, @entry.match("cgag", pos = 0, mismatches = 0, insertions = 2, deletions = 0).insertions) - end - - def test_Pattern_Matcher_scan_locates_three_patterns_ok - entry = Seq.new("test", "ataacgagctagctagctagctgactac") - assert_equal(3, entry.scan("tag").count) - end - - def test_Pattern_Matcher_scan_with_pos_locates_two_patterns_ok - entry = Seq.new("test", "ataacgagctagctagctagctgactac") - assert_equal(2, entry.scan("tag", 10).count) + def test_PatternMatcher_scan_with_pos_locates_two_patterns_ok + p = Seq.new("test", "ataacgagctagctagctagctgactac") + assert_equal(2, p.scan("tag", 10).count) end end diff --git a/code_ruby/Maasha/test/test_seq.rb b/code_ruby/Maasha/test/test_seq.rb index 0520d06..2a00c90 100755 --- a/code_ruby/Maasha/test/test_seq.rb +++ b/code_ruby/Maasha/test/test_seq.rb @@ -332,40 +332,16 @@ class TestSeq < Test::Unit::TestCase assert_equal(25.00, @entry.soft_mask) end - def test_Seq_adaptor_find_with_bad_mis_percent_raises + def test_Seq_adaptor_find_with_bad_ed_percent_raises @entry.seq = "actagctagctacgtacg" - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = -1) } - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = 101) } + assert_raise(SeqError) { @entry.adaptor_find("tacg", ed_percent = -1) } + assert_raise(SeqError) { @entry.adaptor_find("tacg", ed_percent = 101) } end - def test_Seq_adaptor_find_with_ok_mis_percent_dont_raise + def test_Seq_adaptor_find_with_ok_ed_percent_dont_raise @entry.seq = "actagctagctacgtacg" - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 0) } - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 100) } - end - - def test_Seq_adaptor_find_with_bad_ins_percent_raises - @entry.seq = "actagctagctacgtacg" - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = -1) } - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 101) } - end - - def test_Seq_adaptor_find_with_ok_ins_percent_dont_raise - @entry.seq = "actagctagctacgtacg" - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 0) } - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 100) } - end - - def test_Seq_adaptor_find_with_bad_del_percent_raises - @entry.seq = "actagctagctacgtacg" - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 0, del_percent = -1) } - assert_raise(SeqError) { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 0, del_percent = 101) } - end - - def test_Seq_adaptor_find_with_ok_del_percent_dont_raise - @entry.seq = "actagctagctacgtacg" - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 0, del_percent = 0) } - assert_nothing_raised { @entry.adaptor_find("tacg", mis_percent = 0, ins_percent = 0, del_percent = 100) } + assert_nothing_raised { @entry.adaptor_find("tacg", ed_percent = 0) } + assert_nothing_raised { @entry.adaptor_find("tacg", ed_percent = 100) } end def test_Seq_adaptor_find_with_no_match_returns_nil @@ -383,21 +359,21 @@ class TestSeq < Test::Unit::TestCase assert_equal(19, @entry.adaptor_find("gTTTT").pos) end - def test_Seq_adaptor_with_mis_percent_returns_correct_match + def test_Seq_adaptor_with_mis_and_ed_percent_returns_correct_match @entry.seq = "actaaggctagctacgtccg" - assert_equal(0, @entry.adaptor_find("GGGaag", mis_percent = 50).pos) - assert_equal(14, @entry.adaptor_find("cgtcTTTT", mis_percent = 50).pos) + assert_equal(0, @entry.adaptor_find("GGGaag", ed_percent = 50).pos) + assert_equal(14, @entry.adaptor_find("cgtcTTTT", ed_percent = 50).pos) end - def test_Seq_adaptor_with_ins_percent_returns_correct_match + def test_Seq_adaptor_with_ins_and_ed_percent_returns_correct_match @entry.seq = "actaaggctagctacgtccg" - assert_equal(0, @entry.adaptor_find("actGGGaag", mis_percent = 0, ins_percent = 50).pos) - assert_equal(15, @entry.adaptor_find("gtAccgTTTTT", mis_percent = 0, ins_percent = 10).pos) + assert_equal(0, @entry.adaptor_find("actGGGaag", ed_percent = 50).pos) + assert_equal(15, @entry.adaptor_find("gtAccgTTTTT", ed_percent = 10).pos) end - def test_Seq_adaptor_with_del_percent_returns_correct_match + def test_Seq_adaptor_with_del_and_ed_percent_returns_correct_match @entry.seq = "actaaggctagctacgtccg" - assert_equal(0, @entry.adaptor_find("actctag", mis_percent = 0, ins_percent = 0, del_percent = 50).pos) + assert_equal(0, @entry.adaptor_find("actctag", ed_percent = 50).pos) end end -- 2.47.3