X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=sffmultiplecommand.cpp;h=00f23ed24cc83e8eddf66f328a1fe3ce765e122d;hb=541bab1dac00688b4c3a8c4a95ab464412663c50;hp=1675d24a3ee8b9b80e6be67dd0b627846220aef1;hpb=dc383fb61b6d165a8d36e6108df8bc7129243ae6;p=mothur.git diff --git a/sffmultiplecommand.cpp b/sffmultiplecommand.cpp index 1675d24..00f23ed 100644 --- a/sffmultiplecommand.cpp +++ b/sffmultiplecommand.cpp @@ -9,31 +9,49 @@ #include "sffmultiplecommand.h" + //********************************************************************************************************************** vector SffMultipleCommand::setParameters(){ try { - CommandParameter pfile("file", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfile); + CommandParameter pfile("file", "InputTypes", "", "", "none", "none", "none","fasta-name",false,true,true); parameters.push_back(pfile); //sffinfo - CommandParameter ptrim("trim", "Boolean", "", "T", "", "", "",false,false); parameters.push_back(ptrim); + CommandParameter ptrim("trim", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(ptrim); //trim.flows - CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "",false,false); parameters.push_back(pmaxhomop); - CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "",false,false); parameters.push_back(pmaxflows); - CommandParameter pminflows("minflows", "Number", "", "450", "", "", "",false,false); parameters.push_back(pminflows); - CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "",false,false); parameters.push_back(ppdiffs); - CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "",false,false); parameters.push_back(pbdiffs); - CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "",false,false); parameters.push_back(pldiffs); - CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "",false,false); parameters.push_back(psdiffs); - CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "",false,false); parameters.push_back(ptdiffs); - CommandParameter psignal("signal", "Number", "", "0.50", "", "", "",false,false); parameters.push_back(psignal); - CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "",false,false); parameters.push_back(pnoise); - CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "",false,false); parameters.push_back(pallfiles); - CommandParameter porder("order", "String", "", "", "", "", "",false,false); parameters.push_back(porder); + CommandParameter pmaxhomop("maxhomop", "Number", "", "9", "", "", "","",false,false); parameters.push_back(pmaxhomop); + CommandParameter pmaxflows("maxflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pmaxflows); + CommandParameter pminflows("minflows", "Number", "", "450", "", "", "","",false,false); parameters.push_back(pminflows); + CommandParameter ppdiffs("pdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(ppdiffs); + CommandParameter pbdiffs("bdiffs", "Number", "", "0", "", "", "","",false,false,true); parameters.push_back(pbdiffs); + CommandParameter pldiffs("ldiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pldiffs); + CommandParameter psdiffs("sdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(psdiffs); + CommandParameter ptdiffs("tdiffs", "Number", "", "0", "", "", "","",false,false); parameters.push_back(ptdiffs); + CommandParameter psignal("signal", "Number", "", "0.50", "", "", "","",false,false); parameters.push_back(psignal); + CommandParameter pnoise("noise", "Number", "", "0.70", "", "", "","",false,false); parameters.push_back(pnoise); + CommandParameter porder("order", "Multiple", "A-B-I", "A", "", "", "","",false,false, true); parameters.push_back(porder); + //shhh.flows + CommandParameter plookup("lookup", "InputTypes", "", "", "none", "none", "none","",false,false,true); parameters.push_back(plookup); + CommandParameter pcutoff("cutoff", "Number", "", "0.01", "", "", "","",false,false); parameters.push_back(pcutoff); + CommandParameter pmaxiter("maxiter", "Number", "", "1000", "", "", "","",false,false); parameters.push_back(pmaxiter); + CommandParameter plarge("large", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(plarge); + CommandParameter psigma("sigma", "Number", "", "60", "", "", "","",false,false); parameters.push_back(psigma); + CommandParameter pmindelta("mindelta", "Number", "", "0.000001", "", "", "","",false,false); parameters.push_back(pmindelta); + + //trim.seqs parameters + CommandParameter pallfiles("allfiles", "Boolean", "", "t", "", "", "","",false,false); parameters.push_back(pallfiles); + CommandParameter pflip("flip", "Boolean", "", "F", "", "", "","",false,false,true); parameters.push_back(pflip); + CommandParameter pmaxambig("maxambig", "Number", "", "-1", "", "", "","",false,false); parameters.push_back(pmaxambig); + CommandParameter pminlength("minlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pminlength); + CommandParameter pmaxlength("maxlength", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pmaxlength); + CommandParameter pkeepforward("keepforward", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pkeepforward); + CommandParameter pkeepfirst("keepfirst", "Number", "", "0", "", "", "","",false,false); parameters.push_back(pkeepfirst); + CommandParameter premovelast("removelast", "Number", "", "0", "", "", "","",false,false); parameters.push_back(premovelast); - CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors); - CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir); - CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir); + + CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors); + CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir); + CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir); vector myArray; for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); } @@ -49,9 +67,28 @@ string SffMultipleCommand::getHelpString(){ try { string helpString = ""; helpString += "The sff.multiple command reads a file containing sff filenames and optional oligos filenames. It runs the files through sffinfo, trim.flows, shhh.flows and trim.seqs combining the results.\n"; - helpString += "The sff.multiple command parameters are file, trim, maxhomop, maxflows, minflows, pdiffs, bdiffs, ldiffs, sdiffs, tdiffs, signal, noise, allfiles, order. file is required. \n"; + helpString += "The sff.multiple command parameters are: "; + vector parameters = setParameters(); + for (int i = 0; i < parameters.size()-1; i++) { + helpString += parameters[i] + ", "; + } + helpString += parameters[parameters.size()-1] + ".\n"; helpString += "The file parameter allows you to enter the a file containing the list of sff files and optional oligos files.\n"; helpString += "The trim parameter allows you to indicate if you would like a sequences and quality scores generated by sffinfo trimmed to the clipQualLeft and clipQualRight values. Default=True. \n"; + helpString += "The maxambig parameter allows you to set the maximum number of ambigious bases allowed. The default is -1.\n"; + helpString += "The maxhomop parameter allows you to set a maximum homopolymer length. \n"; + helpString += "The minlength parameter allows you to set and minimum sequence length. \n"; + helpString += "The maxlength parameter allows you to set and maximum sequence length. \n"; + helpString += "The tdiffs parameter is used to specify the total number of differences allowed in the sequence. The default is pdiffs + bdiffs + sdiffs + ldiffs.\n"; + helpString += "The bdiffs parameter is used to specify the number of differences allowed in the barcode. The default is 0.\n"; + helpString += "The pdiffs parameter is used to specify the number of differences allowed in the primer. The default is 0.\n"; + helpString += "The ldiffs parameter is used to specify the number of differences allowed in the linker. The default is 0.\n"; + helpString += "The sdiffs parameter is used to specify the number of differences allowed in the spacer. The default is 0.\n"; + helpString += "The allfiles parameter will create separate group and fasta file for each grouping. The default is F.\n"; + helpString += "The keepforward parameter allows you to indicate whether you want the forward primer removed or not. The default is F, meaning remove the forward primer.\n"; + helpString += "The keepfirst parameter trims the sequence to the first keepfirst number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements. \n"; + helpString += "The removelast removes the last removelast number of bases after the barcode or primers are removed, before the sequence is checked to see if it meets the other requirements.\n"; + helpString += "The order parameter options are A, B or I. Default=A. A = TACG and B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"; helpString += "Example sff.multiple(file=mySffOligosFile.txt, trim=F).\n"; helpString += "Note: No spaces between parameter labels (i.e. file), '=' and parameters (i.e.mySffOligosFile.txt).\n"; return helpString; @@ -62,32 +99,22 @@ string SffMultipleCommand::getHelpString(){ } } //********************************************************************************************************************** -string SffMultipleCommand::getOutputFileNameTag(string type, string inputName=""){ - try { - string outputFileName = ""; - map >::iterator it; +string SffMultipleCommand::getOutputPattern(string type) { + try { + string pattern = ""; - //is this a type this command creates - it = outputTypes.find(type); - if (it == outputTypes.end()) { m->mothurOut("[ERROR]: this command doesn't create a " + type + " output file.\n"); } - else { - //if (type == "fasta") { outputFileName = "fasta"; } - //else if (type == "flow") { outputFileName = "flow"; } - // else if (type == "sfftxt") { outputFileName = "sff.txt"; } - //else if (type == "qfile") { outputFileName = "qual"; } - //else { - m->mothurOut("[ERROR]: No definition for type " + type + " output file tag.\n"); m->control_pressed = true; - //} - } - return outputFileName; - } - catch(exception& e) { - m->errorOut(e, "SffMultipleCommand", "getOutputFileNameTag"); - exit(1); - } + if (type == "fasta") { pattern = "[filename],fasta"; } + else if (type == "name") { pattern = "[filename],names"; } + else if (type == "group") { pattern = "[filename],groups"; } + else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; } + + return pattern; + } + catch(exception& e) { + m->errorOut(e, "SffMultipleCommand", "getOutputPattern"); + exit(1); + } } - - //********************************************************************************************************************** SffMultipleCommand::SffMultipleCommand(){ try { @@ -95,8 +122,8 @@ SffMultipleCommand::SffMultipleCommand(){ setParameters(); vector tempOutNames; outputTypes["fasta"] = tempOutNames; - outputTypes["flow"] = tempOutNames; - outputTypes["qfile"] = tempOutNames; + outputTypes["name"] = tempOutNames; + outputTypes["group"] = tempOutNames; } catch(exception& e) { m->errorOut(e, "SffMultipleCommand", "SffMultipleCommand"); @@ -107,7 +134,7 @@ SffMultipleCommand::SffMultipleCommand(){ SffMultipleCommand::SffMultipleCommand(string option) { try { - abort = false; calledHelp = false; + abort = false; calledHelp = false; append=false; makeGroup=false; //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } @@ -131,8 +158,9 @@ SffMultipleCommand::SffMultipleCommand(string option) { //initialize outputTypes vector tempOutNames; outputTypes["fasta"] = tempOutNames; - outputTypes["flow"] = tempOutNames; - outputTypes["qfile"] = tempOutNames; + outputTypes["name"] = tempOutNames; + outputTypes["group"] = tempOutNames; + //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } @@ -149,6 +177,14 @@ SffMultipleCommand::SffMultipleCommand(string option) { //if the user has not given a path then, add inputdir. else leave path alone. if (path == "") { parameters["file"] = inputDir + it->second; } } + + it = parameters.find("lookup"); + //user has given a template file + if(it != parameters.end()){ + path = m->hasPath(it->second); + //if the user has not given a path then, add inputdir. else leave path alone. + if (path == "") { parameters["lookup"] = inputDir + it->second; } + } } filename = validParameter.validFile(parameters, "file", true); @@ -158,6 +194,171 @@ SffMultipleCommand::SffMultipleCommand(string option) { string temp; temp = validParameter.validFile(parameters, "trim", false); if (temp == "not found"){ temp = "T"; } trim = m->isTrue(temp); + + temp = validParameter.validFile(parameters, "minflows", false); if (temp == "not found") { temp = "450"; } + m->mothurConvert(temp, minFlows); + + temp = validParameter.validFile(parameters, "maxflows", false); if (temp == "not found") { temp = "450"; } + m->mothurConvert(temp, maxFlows); + + temp = validParameter.validFile(parameters, "maxhomop", false); if (temp == "not found"){ temp = "9"; } + m->mothurConvert(temp, maxHomoP); + + temp = validParameter.validFile(parameters, "signal", false); if (temp == "not found"){ temp = "0.50"; } + m->mothurConvert(temp, signal); + + temp = validParameter.validFile(parameters, "noise", false); if (temp == "not found"){ temp = "0.70"; } + m->mothurConvert(temp, noise); + + temp = validParameter.validFile(parameters, "bdiffs", false); if (temp == "not found"){ temp = "0"; } + m->mothurConvert(temp, bdiffs); + + temp = validParameter.validFile(parameters, "pdiffs", false); if (temp == "not found"){ temp = "0"; } + m->mothurConvert(temp, pdiffs); + + temp = validParameter.validFile(parameters, "ldiffs", false); if (temp == "not found") { temp = "0"; } + m->mothurConvert(temp, ldiffs); + + temp = validParameter.validFile(parameters, "sdiffs", false); if (temp == "not found") { temp = "0"; } + m->mothurConvert(temp, sdiffs); + + temp = validParameter.validFile(parameters, "tdiffs", false); if (temp == "not found") { int tempTotal = pdiffs + bdiffs + ldiffs + sdiffs; temp = toString(tempTotal); } + m->mothurConvert(temp, tdiffs); + + if(tdiffs == 0){ tdiffs = bdiffs + pdiffs + ldiffs + sdiffs; } + + + temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } + m->setProcessors(temp); + m->mothurConvert(temp, processors); + + temp = validParameter.validFile(parameters, "order", false); if (temp == "not found"){ temp = "A"; } + if (temp.length() > 1) { m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true; + } + else { + if (toupper(temp[0]) == 'A') { flowOrder = "A"; } + else if(toupper(temp[0]) == 'B'){ + flowOrder = "B"; } + else if(toupper(temp[0]) == 'I'){ + flowOrder = "I"; } + else { + m->mothurOut("[ERROR]: " + temp + " is not a valid option for order. order options are A, B, or I. A = TACG, B = TACGTACGTACGATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATAGATCGCATGACGATCGCATATCGTCAGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGTAGTCGAGCATCATCTGACGCAGTACGTGCATGATCTCAGTCAGCAGCTATGTCAGTGCATGCATAGATCGCATGACGATCGCATATCGTCAGTGCAGTGACTGATCGTCATCAGCTAGCATCGACTGCATGATCTCAGTCAGCAGC, and I = TACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGCTACGTACGTCTGAGCATCGATCGATGTACAGC.\n"); abort=true; + } + } + + + temp = validParameter.validFile(parameters, "cutoff", false); if (temp == "not found"){ temp = "0.01"; } + m->mothurConvert(temp, cutoff); + + temp = validParameter.validFile(parameters, "mindelta", false); if (temp == "not found"){ temp = "0.000001"; } + minDelta = temp; + + temp = validParameter.validFile(parameters, "maxiter", false); if (temp == "not found"){ temp = "1000"; } + m->mothurConvert(temp, maxIters); + + temp = validParameter.validFile(parameters, "large", false); if (temp == "not found"){ temp = "0"; } + m->mothurConvert(temp, largeSize); + if (largeSize != 0) { large = true; } + else { large = false; } + if (largeSize < 0) { m->mothurOut("The value of the large cannot be negative.\n"); } + + temp = validParameter.validFile(parameters, "sigma", false);if (temp == "not found") { temp = "60"; } + m->mothurConvert(temp, sigma); + + temp = validParameter.validFile(parameters, "flip", false); + if (temp == "not found") { flip = 0; } + else { flip = m->isTrue(temp); } + + temp = validParameter.validFile(parameters, "maxambig", false); if (temp == "not found") { temp = "-1"; } + m->mothurConvert(temp, maxAmbig); + + temp = validParameter.validFile(parameters, "minlength", false); if (temp == "not found") { temp = "0"; } + m->mothurConvert(temp, minLength); + + temp = validParameter.validFile(parameters, "maxlength", false); if (temp == "not found") { temp = "0"; } + m->mothurConvert(temp, maxLength); + + temp = validParameter.validFile(parameters, "keepfirst", false); if (temp == "not found") { temp = "0"; } + convert(temp, keepFirst); + + temp = validParameter.validFile(parameters, "removelast", false); if (temp == "not found") { temp = "0"; } + convert(temp, removeLast); + + temp = validParameter.validFile(parameters, "allfiles", false); if (temp == "not found") { temp = "F"; } + allFiles = m->isTrue(temp); + + temp = validParameter.validFile(parameters, "keepforward", false); if (temp == "not found") { temp = "F"; } + keepforward = m->isTrue(temp); + + temp = validParameter.validFile(parameters, "lookup", true); + if (temp == "not found") { + lookupFileName = "LookUp_Titanium.pat"; + + int ableToOpen; + ifstream in; + ableToOpen = m->openInputFile(lookupFileName, in, "noerror"); + in.close(); + + //if you can't open it, try input location + if (ableToOpen == 1) { + if (inputDir != "") { //default path is set + string tryPath = inputDir + lookupFileName; + m->mothurOut("Unable to open " + lookupFileName + ". Trying input directory " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + lookupFileName = tryPath; + } + } + + //if you can't open it, try default location + if (ableToOpen == 1) { + if (m->getDefaultPath() != "") { //default path is set + string tryPath = m->getDefaultPath() + m->getSimpleName(lookupFileName); + m->mothurOut("Unable to open " + lookupFileName + ". Trying default " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + lookupFileName = tryPath; + } + } + + //if you can't open it its not in current working directory or inputDir, try mothur excutable location + if (ableToOpen == 1) { + string exepath = m->argv; + string tempPath = exepath; + for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); } + exepath = exepath.substr(0, (tempPath.find_last_of('m'))); + + string tryPath = m->getFullPathName(exepath) + m->getSimpleName(lookupFileName); + m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + lookupFileName = tryPath; + } + + if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; } + } + else if(temp == "not open") { + + lookupFileName = validParameter.validFile(parameters, "lookup", false); + + //if you can't open it its not inputDir, try mothur excutable location + string exepath = m->argv; + string tempPath = exepath; + for (int i = 0; i < exepath.length(); i++) { tempPath[i] = tolower(exepath[i]); } + exepath = exepath.substr(0, (tempPath.find_last_of('m'))); + + string tryPath = m->getFullPathName(exepath) + lookupFileName; + m->mothurOut("Unable to open " + lookupFileName + ". Trying mothur's executable location " + tryPath); m->mothurOutEndLine(); + ifstream in2; + int ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + lookupFileName = tryPath; + + if (ableToOpen == 1) { m->mothurOut("Unable to open " + lookupFileName + "."); m->mothurOutEndLine(); abort=true; } + }else { lookupFileName = temp; } } } catch(exception& e) { @@ -173,28 +374,36 @@ int SffMultipleCommand::execute(){ vector sffFiles, oligosFiles; readFile(sffFiles, oligosFiles); + outputDir = m->hasPath(filename); + string fileroot = outputDir + m->getRootName(m->getSimpleName(filename)); + map variables; + variables["[filename]"] = fileroot; + string fasta = getOutputFileName("fasta",variables); + string name = getOutputFileName("name",variables); + string group = getOutputFileName("group",variables); + if (m->control_pressed) { return 0; } + if (sffFiles.size() < processors) { processors = sffFiles.size(); } + +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) +#else + //trim.flows, shhh.flows cannot handle multiple processors for windows. + processors = 1; m->mothurOut("This command can only use 1 processor on Windows platforms, using 1 processors.\n\n"); +#endif + if (processors == 1) { driver(sffFiles, oligosFiles, 0, sffFiles.size(), fasta, name, group); } + else { createProcesses(sffFiles, oligosFiles, fasta, name, group); } if (m->control_pressed) { for (int i = 0; i < outputNames.size(); i++) { m->mothurRemove(outputNames[i]); } return 0; } - //set fasta file as new current fastafile - string current = ""; - itTypes = outputTypes.find("fasta"); - if (itTypes != outputTypes.end()) { - if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setFastaFile(current); } - } - - itTypes = outputTypes.find("qfile"); - if (itTypes != outputTypes.end()) { - if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setQualFile(current); } - } - - itTypes = outputTypes.find("flow"); - if (itTypes != outputTypes.end()) { - if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setFlowFile(current); } - } - + if (append) { + outputNames.push_back(fasta); outputTypes["fasta"].push_back(fasta); + m->setFastaFile(fasta); + outputNames.push_back(name); outputTypes["name"].push_back(name); + m->setNameFile(name); + if (makeGroup) { outputNames.push_back(group); outputTypes["group"].push_back(group); m->setGroupFile(group); } + } + //report output filenames m->mothurOutEndLine(); m->mothurOut("Output File Names: "); m->mothurOutEndLine(); @@ -214,6 +423,8 @@ int SffMultipleCommand::readFile(vector& sffFiles, vector& oligo ifstream in; m->openInputFile(filename, in); + bool allBlank = true; + bool allFull = true; string oligos, sff; while (!in.eof()) { @@ -222,6 +433,8 @@ int SffMultipleCommand::readFile(vector& sffFiles, vector& oligo in >> sff; + sff = m->getFullPathName(sff); + //ignore file pairing if(sff[0] == '#'){ while (!in.eof()) { char c = in.get(); if (c == 10 || c == 13){ break; } } m->gobble(in); } else { //check for oligos file @@ -230,18 +443,22 @@ int SffMultipleCommand::readFile(vector& sffFiles, vector& oligo // get rest of line in case there is a oligos filename while (!in.eof()) { char c = in.get(); - if (c == 10 || c == 13){ break; } + if (c == 10 || c == 13 || c == -1){ break; } else if (c == 32 || c == 9){;} //space or tab else { oligos += c; } } + sffFiles.push_back(sff); + if (oligos != "") { oligos = m->getFullPathName(oligos); allBlank = false; } + if (oligos == "") { allFull = false; } + oligosFiles.push_back(oligos); //will push a blank if there is not an oligos for this sff file } m->gobble(in); - - sffFiles.push_back(sff); - oligosFiles.push_back(oligos); //will push a blank if there is not an oligos for this sff file } in.close(); + if (allBlank || allFull) { append = true; } + if (allFull) { makeGroup = true; } + return 0; } catch(exception& e) { @@ -250,6 +467,368 @@ int SffMultipleCommand::readFile(vector& sffFiles, vector& oligo } } //********************************************************************************************************************** +//runs sffinfo, summary.seqs, trim.flows, shhh.flows, trim.seqs, summary.seqs for each sff file. +int SffMultipleCommand::driver(vector sffFiles, vector oligosFiles, int start, int end, string fasta, string name, string group){ + try { + m->mothurRemove(fasta); m->mothurRemove(name); m->mothurRemove(group); + int count = 0; + for (int s = start; s < end; s++) { + + string sff = sffFiles[s]; + string oligos = oligosFiles[s]; + + m->mothurOut("\n>>>>>\tProcessing " + sff + " (file " + toString(s+1) + " of " + toString(sffFiles.size()) + ")\t<<<<<\n"); + + //run sff.info + string inputString = "sff=" + sff + ", flow=T"; + if (trim) { inputString += ", trim=T"; } + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + m->mothurOut("Running command: sffinfo(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* sffCommand = new SffInfoCommand(inputString); + sffCommand->execute(); + + if (m->control_pressed){ break; } + + map > filenames = sffCommand->getOutputFiles(); + + delete sffCommand; + m->mothurCalling = false; + m->mothurOutEndLine(); + + //run summary.seqs on the fasta file + string fastaFile = ""; + map >::iterator it = filenames.find("fasta"); + if (it != filenames.end()) { if ((it->second).size() != 0) { fastaFile = (it->second)[0]; } } + else { m->mothurOut("[ERROR]: sffinfo did not create a fasta file, quitting.\n"); m->control_pressed = true; break; } + + inputString = "fasta=" + fastaFile + ", processors=1"; + m->mothurOutEndLine(); + m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* summarySeqsCommand = new SeqSummaryCommand(inputString); + summarySeqsCommand->execute(); + + if (m->control_pressed){ break; } + + map > temp = summarySeqsCommand->getOutputFiles(); + mergeOutputFileList(filenames, temp); + + delete summarySeqsCommand; + m->mothurCalling = false; + + m->mothurOutEndLine(); + + //run trim.flows on the fasta file + string flowFile = ""; + it = filenames.find("flow"); + if (it != filenames.end()) { if ((it->second).size() != 0) { flowFile = (it->second)[0]; } } + else { m->mothurOut("[ERROR]: sffinfo did not create a flow file, quitting.\n"); m->control_pressed = true; break; } + + inputString = "flow=" + flowFile; + if (oligos != "") { inputString += ", oligos=" + oligos; } + inputString += ", maxhomop=" + toString(maxHomoP) + ", maxflows=" + toString(maxFlows) + ", minflows=" + toString(minFlows); + inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs); + inputString += ", tdiffs=" + toString(tdiffs) + ", signal=" + toString(signal) + ", noise=" + toString(noise) + ", order=" + flowOrder + ", processors=1"; + + m->mothurOutEndLine(); + m->mothurOut("Running command: trim.flows(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* trimFlowCommand = new TrimFlowsCommand(inputString); + trimFlowCommand->execute(); + + if (m->control_pressed){ break; } + + temp = trimFlowCommand->getOutputFiles(); + mergeOutputFileList(filenames, temp); + + delete trimFlowCommand; + m->mothurCalling = false; + + + string fileFileName = ""; + flowFile = ""; + if (oligos != "") { + it = temp.find("file"); + if (it != temp.end()) { if ((it->second).size() != 0) { fileFileName = (it->second)[0]; } } + else { m->mothurOut("[ERROR]: trim.flows did not create a file file, quitting.\n"); m->control_pressed = true; break; } + }else { + vector flowFiles; + it = temp.find("flow"); + if (it != temp.end()) { if ((it->second).size() != 0) { flowFiles = (it->second); } } + else { m->mothurOut("[ERROR]: trim.flows did not create a flow file, quitting.\n"); m->control_pressed = true; break; } + + for (int i = 0; i < flowFiles.size(); i++) { + string end = flowFiles[i].substr(flowFiles[i].length()-9); + if (end == "trim.flow") { + flowFile = flowFiles[i]; i+=flowFiles.size(); //if we found the trim.flow file stop looking + } + } + } + + if ((fileFileName == "") && (flowFile == "")) { m->mothurOut("[ERROR]: trim.flows did not create a file file or a trim.flow file, quitting.\n"); m->control_pressed = true; break; } + + if (fileFileName != "") { inputString = "file=" + fileFileName; } + else { inputString = "flow=" + flowFile; } + + inputString += ", lookup=" + lookupFileName + ", cutoff=" + toString(cutoff); + ", maxiters=" + toString(maxIters); + if (large) { inputString += ", large=" + toString(largeSize); } + inputString += ", sigma=" +toString(sigma); + inputString += ", mindelta=" + toString(minDelta); + inputString += ", order=" + flowOrder + ", processors=1"; + + //run shhh.flows + m->mothurOutEndLine(); + m->mothurOut("Running command: shhh.flows(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* shhhFlowCommand = new ShhherCommand(inputString); + shhhFlowCommand->execute(); + + if (m->control_pressed){ break; } + + temp = shhhFlowCommand->getOutputFiles(); + mergeOutputFileList(filenames, temp); + + delete shhhFlowCommand; + m->mothurCalling = false; + + vector fastaFiles; + vector nameFiles; + it = temp.find("fasta"); + if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } } + else { m->mothurOut("[ERROR]: shhh.flows did not create a fasta file, quitting.\n"); m->control_pressed = true; break; } + + it = temp.find("name"); + if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } } + else { m->mothurOut("[ERROR]: shhh.flows did not create a name file, quitting.\n"); m->control_pressed = true; break; } + + //find fasta and name files with the shortest name. This is because if there is a composite name it will be the shortest. + fastaFile = fastaFiles[0]; + for (int i = 1; i < fastaFiles.size(); i++) { if (fastaFiles[i].length() < fastaFile.length()) { fastaFile = fastaFiles[i]; } } + string nameFile = nameFiles[0]; + for (int i = 1; i < nameFiles.size(); i++) { if (nameFiles[i].length() < nameFile.length()) { nameFile = nameFiles[i]; } } + + inputString = "fasta=" + fastaFile + ", name=" + nameFile; + if (oligos != "") { inputString += ", oligos=" + oligos; } + if (allFiles) { inputString += ", allfiles=t"; } + else { inputString += ", allfiles=f"; } + if (flip) { inputString += ", flip=t"; } + else { inputString += ", flip=f"; } + if (keepforward) { inputString += ", keepforward=t"; } + else { inputString += ", keepforward=f"; } + + + inputString += ", pdiffs=" + toString(pdiffs) + ", bdiffs=" + toString(bdiffs) + ", ldiffs=" + toString(ldiffs) + ", sdiffs=" + toString(sdiffs); + inputString += ", tdiffs=" + toString(tdiffs) + ", maxambig=" + toString(maxAmbig) + ", minlength=" + toString(minLength) + ", maxlength=" + toString(maxLength); + if (keepFirst != 0) { inputString += ", keepfirst=" + toString(keepFirst); } + if (removeLast != 0) { inputString += ", removelast=" + toString(removeLast); } + inputString += ", processors=1"; + + //run trim.seqs + m->mothurOutEndLine(); + m->mothurOut("Running command: trim.seqs(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* trimseqsCommand = new TrimSeqsCommand(inputString); + trimseqsCommand->execute(); + + if (m->control_pressed){ break; } + + temp = trimseqsCommand->getOutputFiles(); + mergeOutputFileList(filenames, temp); + + delete trimseqsCommand; + m->mothurCalling = false; + + it = temp.find("fasta"); + if (it != temp.end()) { if ((it->second).size() != 0) { fastaFiles = (it->second); } } + else { m->mothurOut("[ERROR]: trim.seqs did not create a fasta file, quitting.\n"); m->control_pressed = true; break; } + + for (int i = 0; i < fastaFiles.size(); i++) { + string end = fastaFiles[i].substr(fastaFiles[i].length()-10); + if (end == "trim.fasta") { + fastaFile = fastaFiles[i]; i+=fastaFiles.size(); //if we found the trim.fasta file stop looking + } + } + + it = temp.find("name"); + if (it != temp.end()) { if ((it->second).size() != 0) { nameFiles = (it->second); } } + else { m->mothurOut("[ERROR]: trim.seqs did not create a name file, quitting.\n"); m->control_pressed = true; break; } + + for (int i = 0; i < nameFiles.size(); i++) { + string end = nameFiles[i].substr(nameFiles[i].length()-10); + if (end == "trim.names") { + nameFile = nameFiles[i]; i+=nameFiles.size(); //if we found the trim.names file stop looking + } + } + + vector groupFiles; + string groupFile = ""; + if (makeGroup) { + it = temp.find("group"); + if (it != temp.end()) { if ((it->second).size() != 0) { groupFiles = (it->second); } } + + //find group file with the shortest name. This is because if there is a composite group file it will be the shortest. + groupFile = groupFiles[0]; + for (int i = 1; i < groupFiles.size(); i++) { if (groupFiles[i].length() < groupFile.length()) { groupFile = groupFiles[i]; } } + } + + inputString = "fasta=" + fastaFile + ", processors=1, name=" + nameFile; + m->mothurOutEndLine(); + m->mothurOut("Running command: summary.seqs(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + summarySeqsCommand = new SeqSummaryCommand(inputString); + summarySeqsCommand->execute(); + + if (m->control_pressed){ break; } + + temp = summarySeqsCommand->getOutputFiles(); + mergeOutputFileList(filenames, temp); + + delete summarySeqsCommand; + m->mothurCalling = false; + + m->mothurOutEndLine(); + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + + if (append) { + m->appendFiles(fastaFile, fasta); + m->appendFiles(nameFile, name); + if (makeGroup) { m->appendFiles(groupFile, group); } + } + count++; + + for (it = filenames.begin(); it != filenames.end(); it++) { + for (int i = 0; i < (it->second).size(); i++) { + outputNames.push_back((it->second)[i]); outputTypes[it->first].push_back((it->second)[i]); + } + } + } + + return count; + } + catch(exception& e) { + m->errorOut(e, "SffMultipleCommand", "driver"); + exit(1); + } +} +//********************************************************************************************************************** +int SffMultipleCommand::mergeOutputFileList(map >& files, map >& temp){ + try { + map >::iterator it; + for (it = temp.begin(); it != temp.end(); it++) { + map >::iterator it2 = files.find(it->first); + if (it2 == files.end()) { //we do not already have this type so just add it + files[it->first] = it->second; + }else { //merge them + for (int i = 0; i < (it->second).size(); i++) { + files[it->first].push_back((it->second)[i]); + } + } + } + + return 0; + } + catch(exception& e) { + m->errorOut(e, "SffMultipleCommand", "mergeOutputFileList"); + exit(1); + } +} +//********************************************************************************************************************** +int SffMultipleCommand::createProcesses(vector sffFiles, vector oligosFiles, string fasta, string name, string group){ + try { + vector processIDS; + int process = 1; + int num = 0; + + //divide the groups between the processors + vector lines; + vector numFilesToComplete; + int numFilesPerProcessor = sffFiles.size() / processors; + for (int i = 0; i < processors; i++) { + int startIndex = i * numFilesPerProcessor; + int endIndex = (i+1) * numFilesPerProcessor; + if(i == (processors - 1)){ endIndex = sffFiles.size(); } + lines.push_back(linePair(startIndex, endIndex)); + numFilesToComplete.push_back((endIndex-startIndex)); + } + +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) + + //loop through and create all the processes you want + while (process != processors) { + int pid = fork(); + + if (pid > 0) { + processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later + process++; + }else if (pid == 0){ + num = driver(sffFiles, oligosFiles, lines[process].start, lines[process].end, fasta + toString(getpid()) + ".temp", name + toString(getpid()) + ".temp", group + toString(getpid()) + ".temp"); + + //pass numSeqs to parent + ofstream out; + string tempFile = toString(getpid()) + ".num.temp"; + m->openOutputFile(tempFile, out); + out << num << '\t' << outputNames.size() << endl; + for (int i = 0; i < outputNames.size(); i++) { out << outputNames[i] << endl; } + out.close(); + + exit(0); + }else { + m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine(); + for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); } + exit(0); + } + } + + //do my part + num = driver(sffFiles, oligosFiles, lines[0].start, lines[0].end, fasta, name, group); + + //force parent to wait until all the processes are done + for (int i=0;iopenInputFile(tempFile, in); + if (!in.eof()) { + int tempNum = 0; int outputNamesSize = 0; + in >> tempNum >> outputNamesSize; m->gobble(in); + for (int j = 0; j < outputNamesSize; j++) { + string tempName; + in >> tempName; m->gobble(in); + outputNames.push_back(tempName); + } + if (tempNum != numFilesToComplete[i+1]) { + m->mothurOut("[ERROR]: main process expected " + toString(processIDS[i]) + " to complete " + toString(numFilesToComplete[i+1]) + " files, and it only reported completing " + toString(tempNum) + ". This will cause file mismatches. The flow files may be too large to process with multiple processors. \n"); + } + } + in.close(); m->mothurRemove(tempFile); + + if (append) { + m->appendFiles(fasta+toString(processIDS[i])+".temp", fasta); m->mothurRemove(fasta+toString(processIDS[i])+".temp"); + m->appendFiles(name+toString(processIDS[i])+".temp", name); m->mothurRemove(name+toString(processIDS[i])+".temp"); + if (makeGroup) { m->appendFiles(group+toString(processIDS[i])+".temp", group); m->mothurRemove(group+toString(processIDS[i])+".temp"); } + } + } +#endif + return 0; + + } + catch(exception& e) { + m->errorOut(e, "ShhherCommand", "createProcesses"); + exit(1); + } +} +//**********************************************************************************************************************