X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=man%2Fread.dna.Rd;h=f2f2cff005f461a4c6f992f1e17276007fdac9a3;hb=8883719a9139685f26d4c0c4cb26872d5f6d0d96;hp=71473d6a98eb53b5e06379cb86862114d67f351f;hpb=c827059eeafc8cbe41c812b26979543ab287803e;p=ape.git diff --git a/man/read.dna.Rd b/man/read.dna.Rd index 71473d6..f2f2cff 100644 --- a/man/read.dna.Rd +++ b/man/read.dna.Rd @@ -10,9 +10,9 @@ read.dna(file, format = "interleaved", skip = 0, \item{file}{a file name specified by either a variable of mode character, or a double-quoted string.} \item{format}{a character string specifying the format of the DNA - sequences. Three choices are possible: \code{"interleaved"}, - \code{"sequential"}, or \code{"fasta"}, or any unambiguous - abbreviation of these.} + sequences. Four choices are possible: \code{"interleaved"}, + \code{"sequential"}, \code{"clustal"}, or \code{"fasta"}, or any + unambiguous abbreviation of these.} \item{skip}{the number of lines of the input file to skip before beginning to read data.} \item{nlines}{the number of lines to be read (by default the file is @@ -34,8 +34,7 @@ read.dna(file, format = "interleaved", skip = 0, \details{ This function follows the interleaved and sequential formats defined in PHYLIP (Felsenstein, 1993) but with the original feature than there - is no restriction on the lengths of the taxa names (though a data file - with 10-characters-long taxa names is fine as well). For these two + is no restriction on the lengths of the taxa names. For these two formats, the first line of the file must contain the dimensions of the data (the numbers of taxa and the numbers of nucleotides); the sequences are considered as aligned and thus must be of the same @@ -47,7 +46,8 @@ read.dna(file, format = "interleaved", skip = 0, sequential formats, see below). The names of the sequences are read in the file unless the `seq.names' option is used. Particularities for each format are detailed below. - + +\itemize{ \item{Interleaved:}{the function starts to read the sequences when it finds 10 contiguous characters belonging to the ambiguity code of the IUPAC (namely A, C, G, T, U, M, R, W, S, Y, K, V, H, D, B, and @@ -63,13 +63,18 @@ read.dna(file, format = "interleaved", skip = 0, sequences are then read until the number of nucleotides specified in the first line of the file is reached. This is repeated for each taxa.} + \item{Clustal:}{this is the format output by the Clustal programs + (.aln). It is somehow similar to the interleaved format: the + differences being that the dimensions of the data are not indicated + in the file, and the names of the sequences are repeated in each block.} + \item{FASTA:}{This looks like the sequential format but the taxa names (or rather a description of the sequence) are on separate lines beginning with a `greater than' character ``>'' (there may be leading spaces before this character). These lines are taken as taxa names after removing the ``>'' and the possible leading and trailing spaces. All the data in the file before the first sequence is ignored.} -} +}} \value{ a matrix or a list (if \code{format = "fasta"}) of DNA sequences stored in binary format, or of mode character (if \code{as.character = @@ -111,6 +116,14 @@ cat("3 40", " ACTAAAAATT ATCAATCACT", file = "exdna.txt", sep = "\n") ex.dna2 <- read.dna("exdna.txt") +### ... in clustal format... +cat("CLUSTAL (ape) multiple sequence alignment", "", +"No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", +"No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT", +"No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", +" ************************** ****** ****", +file = "exdna.txt", sep = "\n") +ex.dna3 <- read.dna("exdna.txt", format = "clustal") ### ... and in FASTA format cat("> No305", "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT", @@ -119,10 +132,11 @@ cat("> No305", "> No306", "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT", file = "exdna.txt", sep = "\n") -ex.dna3 <- read.dna("exdna.txt", format = "fasta") -### These are the same! +ex.dna4 <- read.dna("exdna.txt", format = "fasta") +### The first three are the same! identical(ex.dna, ex.dna2) identical(ex.dna, ex.dna3) +identical(ex.dna, ex.dna4) unlink("exdna.txt") # clean-up } \keyword{IO}