X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=code_ruby%2Ftest%2Fmaasha%2Ftest_seq.rb;h=f966a5fa47b2387c74f1c2a785b6f8e49082f1be;hb=124ad80bd42309d1e6ea7d10dcffb86938c29069;hp=a90c565072503641160ea2c7c2e24fded0e0563b;hpb=2dddbfc4c5563421b83cce0e81f2e559ed982bab;p=biopieces.git

diff --git a/code_ruby/test/maasha/test_seq.rb b/code_ruby/test/maasha/test_seq.rb
index a90c565..f966a5f 100755
--- a/code_ruby/test/maasha/test_seq.rb
+++ b/code_ruby/test/maasha/test_seq.rb
@@ -9,7 +9,8 @@ class TestSeq < Test::Unit::TestCase
     @entry = Seq.new
   end
 
-  #  def test_Seq# autoremoves whitespace, newlines, and carriage returns
+  #  # autoremoves whitespace, newlines, and carriage returns
+  #  def test_Seq_strip
   #    dna = Seq.new
   #    dna.seq = "A\tT\r\tC\nG  "
   #    assert_equal(dna.seq, "ATCG")
@@ -277,14 +278,22 @@ class TestSeq < Test::Unit::TestCase
     end
   end
 
-  def test_Seq_subseq_with_start_lt_0_raises
-    @entry.seq = "ATCG"
-    assert_raise(SeqError) { @entry.subseq(-1, 1) }
+  def test_Seq_shuffle_returns_correctly
+    orig       = "actgactgactgatcgatcgatcgatcgtactg" 
+    @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+    entry_shuf = @entry.shuffle
+    assert_equal(orig, @entry.seq)
+    assert_not_equal(@entry.seq, entry_shuf.seq)
+  end
+
+  def test_Seq_shuffle_bang_returns_correctly
+    @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+    assert_not_equal(@entry.seq, @entry.shuffle!.seq)
   end
 
-  def test_Seq_subseq_with_length_lt_1_raises
+  def test_Seq_subseq_with_start_lt_0_raises
     @entry.seq = "ATCG"
-    assert_raise(SeqError) { @entry.subseq(0, 0) }
+    assert_raise(SeqError) { @entry.subseq(-1, 1) }
   end
 
   def test_Seq_subseq_with_start_plus_length_gt_seq_raises
@@ -323,11 +332,6 @@ class TestSeq < Test::Unit::TestCase
     assert_raise(SeqError) { @entry.subseq!(-1, 1) }
   end
 
-  def test_Seq_subseq_bang_with_length_lt_1_raises
-    @entry.seq = "ATCG"
-    assert_raise(SeqError) { @entry.subseq!(0, 0) }
-  end
-
   def test_Seq_subseq_bang_with_start_plus_length_gt_seq_raises
     @entry.seq = "ATCG"
     assert_raise(SeqError) { @entry.subseq!(0, 5) }
@@ -378,86 +382,6 @@ class TestSeq < Test::Unit::TestCase
     assert_equal("ATCG", @entry.subseq_rand(4).seq)
   end
 
-  def test_Seq_quality_trim_right_with_missing_seq_raises
-    @entry.qual = "hhhh"
-    assert_raise(SeqError) { @entry.quality_trim_right(20) }
-  end
-
-  def test_Seq_quality_trim_right_with_missing_qual_raises
-    @entry.seq = "ATCG"
-    assert_raise(SeqError) { @entry.quality_trim_right(20) }
-  end
-
-  def test_Seq_quality_trim_right_with_bad_min_raises
-    @entry.seq  = "ATCG"
-    @entry.qual = "hhhh"
-
-    [-1, 41].each do |min|
-      assert_raise(SeqError) { @entry.quality_trim_right(min) }
-    end
-  end
-
-  def test_Seq_quality_trim_right_with_ok_min_dont_raise
-    @entry.seq  = "ATCG"
-    @entry.qual = "hhhh"
-
-    [0, 40].each do |min|
-      assert_nothing_raised { @entry.quality_trim_right(min) }
-    end
-  end
-
-  def test_Seq_quality_trim_right_returns_correctly
-    @entry.seq  = "AAAAATCG"
-    @entry.qual = "hhhhhgfe"
-    @entry.quality_trim_right(38)
-    assert_equal("AAAAAT", @entry.seq) 
-    assert_equal("hhhhhg", @entry.qual) 
-  end
-
-  def test_Seq_quality_trim_left_with_missing_seq_raises
-    @entry.qual = "hhhh"
-    assert_raise(SeqError) { @entry.quality_trim_left(20) }
-  end
-
-  def test_Seq_quality_trim_left_with_missing_qual_raises
-    @entry.seq = "ATCG"
-    assert_raise(SeqError) { @entry.quality_trim_left(20) }
-  end
-
-  def test_Seq_quality_trim_left_with_bad_min_raises
-    @entry.seq  = "ATCG"
-    @entry.qual = "hhhh"
-
-    [-1, 41].each do |min|
-      assert_raise(SeqError) { @entry.quality_trim_left(min) }
-    end
-  end
-
-  def test_Seq_quality_trim_left_with_ok_min_dont_raise
-    @entry.seq  = "ATCG"
-    @entry.qual = "hhhh"
-
-    [0, 40].each do |min|
-      assert_nothing_raised { @entry.quality_trim_left(min) }
-    end
-  end
-
-  def test_Seq_quality_trim_left_returns_correctly
-    @entry.seq  = "GCTAAAAA"
-    @entry.qual = "efghhhhh"
-    @entry.quality_trim_left(38)
-    assert_equal("TAAAAA", @entry.seq) 
-    assert_equal("ghhhhh", @entry.qual) 
-  end
-
-  def test_Seq_quality_trim_returns_correctly
-    @entry.seq  = "GCTAAAAAGTG"
-    @entry.qual = "efghhhhhgfe"
-    @entry.quality_trim(38)
-    assert_equal("TAAAAAG", @entry.seq) 
-    assert_equal("ghhhhhg", @entry.qual) 
-  end
-
   def test_Seq_indels_remove_without_qual_returns_correctly
     @entry.seq  = "A-T.CG~CG"
     @entry.qual = nil
@@ -578,6 +502,55 @@ class TestSeq < Test::Unit::TestCase
     assert_equal("-atCG", @entry.mask_seq_soft!(20).seq)
   end
 
+  # qual score detection
+
+  def test_Seq_qual_base33_returns_correctly
+    # self.qual.match(/[!-:]/)
+    @entry.qual = '!"#$%&\'()*+,-./0123456789:'
+    assert_equal(true,  @entry.qual_base33? )
+    @entry.qual = 32.chr
+    assert_equal(false, @entry.qual_base33? )
+    @entry.qual = 59.chr
+    assert_equal(false, @entry.qual_base33? )
+  end
+
+  def test_Seq_qual_base64_returns_correctly
+    # self.qual.match(/[K-h]/)
+    @entry.qual = 'KLMNOPQRSTUVWXYZ[\]^_`abcdefgh'
+    assert_equal(true,  @entry.qual_base64? )
+    @entry.qual = 74.chr
+    assert_equal(false, @entry.qual_base64? )
+    @entry.qual = 105.chr
+    assert_equal(false, @entry.qual_base64? )
+  end
+
+  def test_Seq_qual_valid_with_nil_qual_raises
+    assert_raise(SeqError) { @entry.qual_valid?("illumina1.8") }
+  end
+
+  def test_Seq_qual_valid_with_bad_encoding_raises
+    @entry.qual = "abc"
+    assert_raise(SeqError) { @entry.qual_valid?("foobar") }
+  end
+
+  def test_Seq_qual_valid_returns_correctly
+    tests = [["sanger",      0, 93, 33],
+             ["454",         0, 62, 64],
+             ["solexa",     -5, 62, 64],
+             ["illumina13",  0, 62, 64],
+             ["illumina15",  0, 62, 64],
+             ["illumina18",  0, 93, 33]]
+
+    tests.each do |test|
+      @entry.qual = (test[1] + test[-1]).chr + (test[2] + test[-1]).chr
+      assert_equal(true, @entry.qual_valid?(test[0]))
+      @entry.qual = (test[1] + test[-1] - 1).chr
+      assert_equal(false, @entry.qual_valid?(test[0]))
+      @entry.qual = (test[2] + test[-1] + 1).chr
+      assert_equal(false, @entry.qual_valid?(test[0]))
+    end
+  end
+
   # convert sanger to ...
 
   def test_Seq_convert_scores_bang_from_sanger_to_sanger_returns_OK
@@ -712,6 +685,16 @@ class TestSeq < Test::Unit::TestCase
     @entry.qual = 'BCDEFGHI'
     assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'illumina18').qual)
   end
+
+  def test_Seq_scores_mean_without_qual_raises
+    @entry.qual = nil
+    assert_raise(SeqError) { @entry.scores_mean }
+  end
+
+  def test_Seq_scores_mean_returns_correctly
+    @entry.qual = '@@hh'
+    assert_equal(20.0, @entry.scores_mean)
+  end
 end
 
 __END__