X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=code_ruby%2Ftest%2Fmaasha%2Ftest_seq.rb;h=8bc6852927235b939414d80a02329b3b5490def7;hb=b982cc677363d7458963b610ec53bf2c4f7476a9;hp=a4d47ad203d601a54a5012855c1ca3942976e186;hpb=4228c538897ac3ce803984d5219473e890277b6e;p=biopieces.git diff --git a/code_ruby/test/maasha/test_seq.rb b/code_ruby/test/maasha/test_seq.rb index a4d47ad..8bc6852 100755 --- a/code_ruby/test/maasha/test_seq.rb +++ b/code_ruby/test/maasha/test_seq.rb @@ -9,7 +9,8 @@ class TestSeq < Test::Unit::TestCase @entry = Seq.new end - # def test_Seq# autoremoves whitespace, newlines, and carriage returns + # # autoremoves whitespace, newlines, and carriage returns + # def test_Seq_strip # dna = Seq.new # dna.seq = "A\tT\r\tC\nG " # assert_equal(dna.seq, "ATCG") @@ -218,7 +219,15 @@ class TestSeq < Test::Unit::TestCase def test_Seq_reverse_returns_correctly @entry.seq = "ATCG" - assert_equal("GCTA", @entry.reverse.seq) + new_entry = @entry.reverse + assert_equal("GCTA", new_entry.seq) + assert_equal("ATCG", @entry.seq) + end + + def test_Seq_reverse_bang_returns_correctly + @entry.seq = "ATCG" + @entry.reverse! + assert_equal("GCTA", @entry.seq) end def test_Seq_complement_raises_if_no_sequence @@ -235,27 +244,43 @@ class TestSeq < Test::Unit::TestCase def test_Seq_complement_for_DNA_is_correct @entry.seq = 'ATCGatcg' @entry.type = 'dna' - assert_equal("TAGCtagc", @entry.complement) + comp = @entry.complement + assert_equal("TAGCtagc", comp.seq) + assert_equal("ATCGatcg", @entry.seq) end def test_Seq_complement_for_RNA_is_correct @entry.seq = 'AUCGaucg' @entry.type = 'rna' - assert_equal("UAGCuagc", @entry.complement) + comp = @entry.complement + assert_equal("UAGCuagc", comp.seq) + assert_equal("AUCGaucg", @entry.seq) + end + + def test_Seq_complement_bang_raises_if_no_sequence + @entry.type = 'dna' + assert_raise(SeqError) { @entry.complement! } + end + + def test_Seq_complement_bang_raises_on_bad_type + @entry.seq = 'ATCG' + @entry.type = 'protein' + assert_raise(SeqError) { @entry.complement! } end - def test_Seq_reverse_complement_for_DNA_is_correct + def test_Seq_complement_bang_for_DNA_is_correct @entry.seq = 'ATCGatcg' @entry.type = 'dna' - assert_equal("cgatCGAT", @entry.reverse_complement.seq) + assert_equal("TAGCtagc", @entry.complement!.seq) end - def test_Seq_reverse_complement_for_RNA_is_correct + def test_Seq_complement_bang_for_RNA_is_correct @entry.seq = 'AUCGaucg' @entry.type = 'rna' - assert_equal("cgauCGAU", @entry.reverse_complement.seq) + assert_equal("UAGCuagc", @entry.complement!.seq) end + def test_Seq_hamming_distance_returns_correctly seq1 = Seq.new("test1", "ATCG") seq2 = Seq.new("test2", "atgg") @@ -277,14 +302,22 @@ class TestSeq < Test::Unit::TestCase end end - def test_Seq_subseq_with_start_lt_0_raises - @entry.seq = "ATCG" - assert_raise(SeqError) { @entry.subseq(-1, 1) } + def test_Seq_shuffle_returns_correctly + orig = "actgactgactgatcgatcgatcgatcgtactg" + @entry.seq = "actgactgactgatcgatcgatcgatcgtactg" + entry_shuf = @entry.shuffle + assert_equal(orig, @entry.seq) + assert_not_equal(@entry.seq, entry_shuf.seq) + end + + def test_Seq_shuffle_bang_returns_correctly + @entry.seq = "actgactgactgatcgatcgatcgatcgtactg" + assert_not_equal(@entry.seq, @entry.shuffle!.seq) end - def test_Seq_subseq_with_length_lt_1_raises + def test_Seq_subseq_with_start_lt_0_raises @entry.seq = "ATCG" - assert_raise(SeqError) { @entry.subseq(0, 0) } + assert_raise(SeqError) { @entry.subseq(-1, 1) } end def test_Seq_subseq_with_start_plus_length_gt_seq_raises @@ -323,11 +356,6 @@ class TestSeq < Test::Unit::TestCase assert_raise(SeqError) { @entry.subseq!(-1, 1) } end - def test_Seq_subseq_bang_with_length_lt_1_raises - @entry.seq = "ATCG" - assert_raise(SeqError) { @entry.subseq!(0, 0) } - end - def test_Seq_subseq_bang_with_start_plus_length_gt_seq_raises @entry.seq = "ATCG" assert_raise(SeqError) { @entry.subseq!(0, 5) } @@ -378,86 +406,6 @@ class TestSeq < Test::Unit::TestCase assert_equal("ATCG", @entry.subseq_rand(4).seq) end - def test_Seq_quality_trim_right_with_missing_seq_raises - @entry.qual = "hhhh" - assert_raise(SeqError) { @entry.quality_trim_right(20) } - end - - def test_Seq_quality_trim_right_with_missing_qual_raises - @entry.seq = "ATCG" - assert_raise(SeqError) { @entry.quality_trim_right(20) } - end - - def test_Seq_quality_trim_right_with_bad_min_raises - @entry.seq = "ATCG" - @entry.qual = "hhhh" - - [-1, 41].each do |min| - assert_raise(SeqError) { @entry.quality_trim_right(min) } - end - end - - def test_Seq_quality_trim_right_with_ok_min_dont_raise - @entry.seq = "ATCG" - @entry.qual = "hhhh" - - [0, 40].each do |min| - assert_nothing_raised { @entry.quality_trim_right(min) } - end - end - - def test_Seq_quality_trim_right_returns_correctly - @entry.seq = "AAAAATCG" - @entry.qual = "hhhhhgfe" - @entry.quality_trim_right(38) - assert_equal("AAAAAT", @entry.seq) - assert_equal("hhhhhg", @entry.qual) - end - - def test_Seq_quality_trim_left_with_missing_seq_raises - @entry.qual = "hhhh" - assert_raise(SeqError) { @entry.quality_trim_left(20) } - end - - def test_Seq_quality_trim_left_with_missing_qual_raises - @entry.seq = "ATCG" - assert_raise(SeqError) { @entry.quality_trim_left(20) } - end - - def test_Seq_quality_trim_left_with_bad_min_raises - @entry.seq = "ATCG" - @entry.qual = "hhhh" - - [-1, 41].each do |min| - assert_raise(SeqError) { @entry.quality_trim_left(min) } - end - end - - def test_Seq_quality_trim_left_with_ok_min_dont_raise - @entry.seq = "ATCG" - @entry.qual = "hhhh" - - [0, 40].each do |min| - assert_nothing_raised { @entry.quality_trim_left(min) } - end - end - - def test_Seq_quality_trim_left_returns_correctly - @entry.seq = "GCTAAAAA" - @entry.qual = "efghhhhh" - @entry.quality_trim_left(38) - assert_equal("TAAAAA", @entry.seq) - assert_equal("ghhhhh", @entry.qual) - end - - def test_Seq_quality_trim_returns_correctly - @entry.seq = "GCTAAAAAGTG" - @entry.qual = "efghhhhhgfe" - @entry.quality_trim(38) - assert_equal("TAAAAAG", @entry.seq) - assert_equal("ghhhhhg", @entry.qual) - end - def test_Seq_indels_remove_without_qual_returns_correctly @entry.seq = "A-T.CG~CG" @entry.qual = nil @@ -509,7 +457,268 @@ class TestSeq < Test::Unit::TestCase @entry.seq = "--AAAa" assert_equal(25.00, @entry.soft_mask) end -end + def test_Seq_mask_seq_hard_bang_with_nil_seq_raises + @entry.seq = nil + @entry.qual = "" + + assert_raise(SeqError) { @entry.mask_seq_hard!(20) } + end + + def test_Seq_mask_seq_hard_bang_with_nil_qual_raises + @entry.seq = "" + @entry.qual = nil + + assert_raise(SeqError) { @entry.mask_seq_hard!(20) } + end + + def test_Seq_mask_seq_hard_bang_with_bad_cutoff_raises + assert_raise(SeqError) { @entry.mask_seq_hard!(-1) } + assert_raise(SeqError) { @entry.mask_seq_hard!(41) } + end + + def test_Seq_mask_seq_hard_bang_with_OK_cutoff_dont_raise + @entry.seq = "ATCG" + @entry.qual = "RSTU" + + assert_nothing_raised { @entry.mask_seq_hard!(0) } + assert_nothing_raised { @entry.mask_seq_hard!(40) } + end + + def test_Seq_mask_seq_hard_bang_returns_correctly + @entry.seq = "-ATCG" + @entry.qual = "RRSTU" + + assert_equal("-NNCG", @entry.mask_seq_hard!(20).seq) + end + + def test_Seq_mask_seq_soft_bang_with_nil_seq_raises + @entry.seq = nil + @entry.qual = "" + + assert_raise(SeqError) { @entry.mask_seq_soft!(20) } + end + + def test_Seq_mask_seq_soft_bang_with_nil_qual_raises + @entry.seq = "" + @entry.qual = nil + + assert_raise(SeqError) { @entry.mask_seq_soft!(20) } + end + + def test_Seq_mask_seq_soft_bang_with_bad_cutoff_raises + assert_raise(SeqError) { @entry.mask_seq_soft!(-1) } + assert_raise(SeqError) { @entry.mask_seq_soft!(41) } + end + + def test_Seq_mask_seq_soft_bang_with_OK_cutoff_dont_raise + @entry.seq = "ATCG" + @entry.qual = "RSTU" + + assert_nothing_raised { @entry.mask_seq_soft!(0) } + assert_nothing_raised { @entry.mask_seq_soft!(40) } + end + + def test_Seq_mask_seq_soft_bang_returns_correctly + @entry.seq = "-ATCG" + @entry.qual = "RRSTU" + + assert_equal("-atCG", @entry.mask_seq_soft!(20).seq) + end + + # qual score detection + + def test_Seq_qual_base33_returns_correctly + # self.qual.match(/[!-:]/) + @entry.qual = '!"#$%&\'()*+,-./0123456789:' + assert_equal(true, @entry.qual_base33? ) + @entry.qual = 32.chr + assert_equal(false, @entry.qual_base33? ) + @entry.qual = 59.chr + assert_equal(false, @entry.qual_base33? ) + end + + def test_Seq_qual_base64_returns_correctly + # self.qual.match(/[K-h]/) + @entry.qual = 'KLMNOPQRSTUVWXYZ[\]^_`abcdefgh' + assert_equal(true, @entry.qual_base64? ) + @entry.qual = 74.chr + assert_equal(false, @entry.qual_base64? ) + @entry.qual = 105.chr + assert_equal(false, @entry.qual_base64? ) + end + + def test_Seq_qual_valid_with_nil_qual_raises + assert_raise(SeqError) { @entry.qual_valid?("illumina1.8") } + end + + def test_Seq_qual_valid_with_bad_encoding_raises + @entry.qual = "abc" + assert_raise(SeqError) { @entry.qual_valid?("foobar") } + end + + def test_Seq_qual_valid_returns_correctly + tests = [["sanger", 0, 93, 33], + ["454", 0, 62, 64], + ["solexa", -5, 62, 64], + ["illumina13", 0, 62, 64], + ["illumina15", 0, 62, 64], + ["illumina18", 0, 93, 33]] + + tests.each do |test| + @entry.qual = (test[1] + test[-1]).chr + (test[2] + test[-1]).chr + assert_equal(true, @entry.qual_valid?(test[0])) + @entry.qual = (test[1] + test[-1] - 1).chr + assert_equal(false, @entry.qual_valid?(test[0])) + @entry.qual = (test[2] + test[-1] + 1).chr + assert_equal(false, @entry.qual_valid?(test[0])) + end + end + + # convert sanger to ... + + def test_Seq_convert_scores_bang_from_sanger_to_sanger_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('sanger', 'sanger').qual) + end + + def test_Seq_convert_scores_bang_from_sanger_to_solexa_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'solexa').qual) + end + + def test_Seq_convert_scores_bang_from_sanger_to_illumina13_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'illumina13').qual) + end + + def test_Seq_convert_scores_bang_from_sanger_to_illumina15_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'illumina15').qual) + end + + def test_Seq_convert_scores_bang_from_sanger_to_illumina18_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('sanger', 'illumina18').qual) + end + + # convert solexa to ... + + def test_Seq_convert_scores_bang_from_solexa_to_sanger_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('solexa', 'sanger').qual) + end + + def test_Seq_convert_scores_bang_from_solexa_to_solexa_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'solexa').qual) + end + + def test_Seq_convert_scores_bang_from_solexa_to_illumina13_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'illumina13').qual) + end + + def test_Seq_convert_scores_bang_from_solexa_to_illumina15_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'illumina15').qual) + end + + def test_Seq_convert_scores_bang_from_solexa_to_illumina18_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('solexa', 'illumina18').qual) + end + + # convert illumina13 to ... + + def test_Seq_convert_scores_bang_from_illumina13_to_sanger_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina13', 'sanger').qual) + end + + def test_Seq_convert_scores_bang_from_illumina13_to_solexa_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'solexa').qual) + end + + def test_Seq_convert_scores_bang_from_illumina13_to_illumina13_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'illumina13').qual) + end + + def test_Seq_convert_scores_bang_from_illumina13_to_illumina15_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'illumina15').qual) + end + + def test_Seq_convert_scores_bang_from_illumina13_to_illumina18_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina13', 'illumina18').qual) + end + + # convert illumina15 to ... + + def test_Seq_convert_scores_bang_from_illumina15_to_sanger_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina15', 'sanger').qual) + end + + def test_Seq_convert_scores_bang_from_illumina15_to_solexa_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'solexa').qual) + end + + def test_Seq_convert_scores_bang_from_illumina15_to_illumina13_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'illumina13').qual) + end + + def test_Seq_convert_scores_bang_from_illumina15_to_illumina15_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'illumina15').qual) + end + + def test_Seq_convert_scores_bang_from_illumina15_to_illumina18_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina15', 'illumina18').qual) + end + + # convert illumina18 to ... + + def test_Seq_convert_scores_bang_from_illumina18_to_sanger_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'sanger').qual) + end + + def test_Seq_convert_scores_bang_from_illumina18_to_solexa_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'solexa').qual) + end + + def test_Seq_convert_scores_bang_from_illumina18_to_illumina13_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'illumina13').qual) + end + + def test_Seq_convert_scores_bang_from_illumina18_to_illumina15_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'illumina15').qual) + end + + def test_Seq_convert_scores_bang_from_illumina18_to_illumina18_returns_OK + @entry.qual = 'BCDEFGHI' + assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'illumina18').qual) + end + + def test_Seq_scores_mean_without_qual_raises + @entry.qual = nil + assert_raise(SeqError) { @entry.scores_mean } + end + + def test_Seq_scores_mean_returns_correctly + @entry.qual = '@@hh' + assert_equal(20.0, @entry.scores_mean) + end +end __END__