X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=chimerauchimecommand.cpp;h=3a9f42b22e0715ccf1f68313439342269da81bf8;hb=37b23ba7d98eca13d02cde8d3b1ad08ac92fefb9;hp=891b77b63a082c43002d337986ba258e8f88ee0f;hpb=fd98ee6efb944d38bbd61fc36ea9fea2557e3830;p=mothur.git diff --git a/chimerauchimecommand.cpp b/chimerauchimecommand.cpp index 891b77b..3a9f42b 100644 --- a/chimerauchimecommand.cpp +++ b/chimerauchimecommand.cpp @@ -9,20 +9,44 @@ #include "chimerauchimecommand.h" #include "deconvolutecommand.h" -#include "uc.h" +//#include "uc.h" #include "sequence.hpp" - +#include "referencedb.h" +#include "systemcommand.h" //********************************************************************************************************************** vector ChimeraUchimeCommand::setParameters(){ try { - CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(ptemplate); - CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none",false,true); parameters.push_back(pfasta); - CommandParameter pname("name", "InputTypes", "", "", "none", "none", "none",false,false); parameters.push_back(pname); - CommandParameter pprocessors("processors", "Number", "", "1", "", "", "",false,false); parameters.push_back(pprocessors); - CommandParameter pinputdir("inputdir", "String", "", "", "", "", "",false,false); parameters.push_back(pinputdir); - CommandParameter poutputdir("outputdir", "String", "", "", "", "", "",false,false); parameters.push_back(poutputdir); - + CommandParameter ptemplate("reference", "InputTypes", "", "", "none", "none", "none","",false,true,true); parameters.push_back(ptemplate); + CommandParameter pfasta("fasta", "InputTypes", "", "", "none", "none", "none","chimera-accnos",false,true,true); parameters.push_back(pfasta); + CommandParameter pname("name", "InputTypes", "", "", "NameCount", "none", "none","",false,false,true); parameters.push_back(pname); + CommandParameter pcount("count", "InputTypes", "", "", "NameCount-CountGroup", "none", "none","",false,false,true); parameters.push_back(pcount); + CommandParameter pgroup("group", "InputTypes", "", "", "CountGroup", "none", "none","",false,false,true); parameters.push_back(pgroup); + CommandParameter pprocessors("processors", "Number", "", "1", "", "", "","",false,false,true); parameters.push_back(pprocessors); + CommandParameter pstrand("strand", "String", "", "", "", "", "","",false,false); parameters.push_back(pstrand); + CommandParameter pinputdir("inputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(pinputdir); + CommandParameter poutputdir("outputdir", "String", "", "", "", "", "","",false,false); parameters.push_back(poutputdir); + CommandParameter pabskew("abskew", "Number", "", "1.9", "", "", "","",false,false); parameters.push_back(pabskew); + CommandParameter pchimealns("chimealns", "Boolean", "", "F", "", "", "","alns",false,false); parameters.push_back(pchimealns); + CommandParameter pminh("minh", "Number", "", "0.3", "", "", "","",false,false); parameters.push_back(pminh); + CommandParameter pmindiv("mindiv", "Number", "", "0.5", "", "", "","",false,false); parameters.push_back(pmindiv); + CommandParameter pxn("xn", "Number", "", "8.0", "", "", "","",false,false); parameters.push_back(pxn); + CommandParameter pdn("dn", "Number", "", "1.4", "", "", "","",false,false); parameters.push_back(pdn); + CommandParameter pxa("xa", "Number", "", "1", "", "", "","",false,false); parameters.push_back(pxa); + CommandParameter pchunks("chunks", "Number", "", "4", "", "", "","",false,false); parameters.push_back(pchunks); + CommandParameter pminchunk("minchunk", "Number", "", "64", "", "", "","",false,false); parameters.push_back(pminchunk); + CommandParameter pidsmoothwindow("idsmoothwindow", "Number", "", "32", "", "", "","",false,false); parameters.push_back(pidsmoothwindow); + CommandParameter pdups("dereplicate", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pdups); + + //CommandParameter pminsmoothid("minsmoothid", "Number", "", "0.95", "", "", "",false,false); parameters.push_back(pminsmoothid); + CommandParameter pmaxp("maxp", "Number", "", "2", "", "", "","",false,false); parameters.push_back(pmaxp); + CommandParameter pskipgaps("skipgaps", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(pskipgaps); + CommandParameter pskipgaps2("skipgaps2", "Boolean", "", "T", "", "", "","",false,false); parameters.push_back(pskipgaps2); + CommandParameter pminlen("minlen", "Number", "", "10", "", "", "","",false,false); parameters.push_back(pminlen); + CommandParameter pmaxlen("maxlen", "Number", "", "10000", "", "", "","",false,false); parameters.push_back(pmaxlen); + CommandParameter pucl("ucl", "Boolean", "", "F", "", "", "","",false,false); parameters.push_back(pucl); + CommandParameter pqueryfract("queryfract", "Number", "", "0.5", "", "", "","",false,false); parameters.push_back(pqueryfract); + vector myArray; for (int i = 0; i < parameters.size(); i++) { myArray.push_back(parameters[i].name); } return myArray; @@ -38,12 +62,33 @@ string ChimeraUchimeCommand::getHelpString(){ string helpString = ""; helpString += "The chimera.uchime command reads a fastafile and referencefile and outputs potentially chimeric sequences.\n"; helpString += "This command is a wrapper for uchime written by Robert C. Edgar.\n"; - helpString += "The chimera.uchime command parameters are fasta, name, reference and processors.\n"; + helpString += "The chimera.uchime command parameters are fasta, name, count, reference, processors, dereplicate, abskew, chimealns, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, skipgaps, skipgaps2, minlen, maxlen, ucl, strand and queryfact.\n"; helpString += "The fasta parameter allows you to enter the fasta file containing your potentially chimeric sequences, and is required, unless you have a valid current fasta file. \n"; helpString += "The name parameter allows you to provide a name file, if you are using template=self. \n"; + helpString += "The count parameter allows you to provide a count file, if you are using template=self. When you use a count file with group info and dereplicate=T, mothur will create a *.pick.count_table file containing seqeunces after chimeras are removed. \n"; helpString += "You may enter multiple fasta files by separating their names with dashes. ie. fasta=abrecovery.fasta-amazon.fasta \n"; + helpString += "The group parameter allows you to provide a group file. The group file can be used with a namesfile and reference=self. When checking sequences, only sequences from the same group as the query sequence will be used as the reference. \n"; + helpString += "If the dereplicate parameter is false, then if one group finds the seqeunce to be chimeric, then all groups find it to be chimeric, default=f.\n"; helpString += "The reference parameter allows you to enter a reference file containing known non-chimeric sequences, and is required. You may also set template=self, in this case the abundant sequences will be used as potential parents. \n"; helpString += "The processors parameter allows you to specify how many processors you would like to use. The default is 1. \n"; + helpString += "The abskew parameter can only be used with template=self. Minimum abundance skew. Default 1.9. Abundance skew is: min [ abund(parent1), abund(parent2) ] / abund(query).\n"; + helpString += "The chimealns parameter allows you to indicate you would like a file containing multiple alignments of query sequences to parents in human readable format. Alignments show columns with differences that support or contradict a chimeric model.\n"; + helpString += "The minh parameter - mininum score to report chimera. Default 0.3. Values from 0.1 to 5 might be reasonable. Lower values increase sensitivity but may report more false positives. If you decrease xn you may need to increase minh, and vice versa.\n"; + helpString += "The mindiv parameter - minimum divergence ratio, default 0.5. Div ratio is 100%% - %%identity between query sequence and the closest candidate for being a parent. If you don't care about very close chimeras, then you could increase mindiv to, say, 1.0 or 2.0, and also decrease minh, say to 0.1, to increase sensitivity. How well this works will depend on your data. Best is to tune parameters on a good benchmark.\n"; + helpString += "The xn parameter - weight of a no vote. Default 8.0. Decreasing this weight to around 3 or 4 may give better performance on denoised data.\n"; + helpString += "The dn parameter - pseudo-count prior on number of no votes. Default 1.4. Probably no good reason to change this unless you can retune to a good benchmark for your data. Reasonable values are probably in the range from 0.2 to 2.\n"; + helpString += "The xa parameter - weight of an abstain vote. Default 1. So far, results do not seem to be very sensitive to this parameter, but if you have a good training set might be worth trying. Reasonable values might range from 0.1 to 2.\n"; + helpString += "The chunks parameter is the number of chunks to extract from the query sequence when searching for parents. Default 4.\n"; + helpString += "The minchunk parameter is the minimum length of a chunk. Default 64.\n"; + helpString += "The idsmoothwindow parameter is the length of id smoothing window. Default 32.\n"; + //helpString += "The minsmoothid parameter - minimum factional identity over smoothed window of candidate parent. Default 0.95.\n"; + helpString += "The maxp parameter - maximum number of candidate parents to consider. Default 2. In tests so far, increasing maxp gives only a very small improvement in sensivity but tends to increase the error rate quite a bit.\n"; + helpString += "The skipgaps parameter controls how gapped columns affect counting of diffs. If skipgaps is set to T, columns containing gaps do not found as diffs. Default = T.\n"; + helpString += "The skipgaps2 parameter controls how gapped columns affect counting of diffs. If skipgaps2 is set to T, if column is immediately adjacent to a column containing a gap, it is not counted as a diff. Default = T.\n"; + helpString += "The minlen parameter is the minimum unaligned sequence length. Defaults 10. Applies to both query and reference sequences.\n"; + helpString += "The maxlen parameter is the maximum unaligned sequence length. Defaults 10000. Applies to both query and reference sequences.\n"; + helpString += "The ucl parameter - use local-X alignments. Default is global-X or false. On tests so far, global-X is always better; this option is retained because it just might work well on some future type of data.\n"; + helpString += "The queryfract parameter - minimum fraction of the query sequence that must be covered by a local-X alignment. Default 0.5. Applies only when ucl is true.\n"; #ifdef USE_MPI helpString += "When using MPI, the processors parameter is set to the number of MPI processes running. \n"; #endif @@ -59,6 +104,24 @@ string ChimeraUchimeCommand::getHelpString(){ } } //********************************************************************************************************************** +string ChimeraUchimeCommand::getOutputPattern(string type) { + try { + string pattern = ""; + + if (type == "chimera") { pattern = "[filename],uchime.chimeras"; } + else if (type == "accnos") { pattern = "[filename],uchime.accnos"; } + else if (type == "alns") { pattern = "[filename],uchime.alns"; } + else if (type == "count") { pattern = "[filename],uchime.pick.count_table"; } + else { m->mothurOut("[ERROR]: No definition for type " + type + " output pattern.\n"); m->control_pressed = true; } + + return pattern; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "getOutputPattern"); + exit(1); + } +} +//********************************************************************************************************************** ChimeraUchimeCommand::ChimeraUchimeCommand(){ try { abort = true; calledHelp = true; @@ -66,6 +129,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(){ vector tempOutNames; outputTypes["chimera"] = tempOutNames; outputTypes["accnos"] = tempOutNames; + outputTypes["alns"] = tempOutNames; + outputTypes["count"] = tempOutNames; } catch(exception& e) { m->errorOut(e, "ChimeraUchimeCommand", "ChimeraUchimeCommand"); @@ -75,7 +140,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(){ //*************************************************************************************************************** ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { try { - abort = false; calledHelp = false; + abort = false; calledHelp = false; hasName=false; hasCount=false; + ReferenceDB* rdb = ReferenceDB::getInstance(); //allow user to run help if(option == "help") { help(); abort = true; calledHelp = true; } @@ -98,6 +164,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { vector tempOutNames; outputTypes["chimera"] = tempOutNames; outputTypes["accnos"] = tempOutNames; + outputTypes["alns"] = tempOutNames; + outputTypes["count"] = tempOutNames; //if the user changes the input directory command factory will send this info to us in the output parameter string inputDir = validParameter.validFile(parameters, "inputdir", false); @@ -171,6 +239,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { //erase from file list fastaFileNames.erase(fastaFileNames.begin()+i); i--; + }else { + m->setFastaFile(fastaFileNames[i]); } } } @@ -181,9 +251,8 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { //check for required parameters - bool hasName = true; namefile = validParameter.validFile(parameters, "name", false); - if (namefile == "not found") { namefile = ""; hasName = false; } + if (namefile == "not found") { namefile = ""; } else { m->splitAtDash(namefile, nameFileNames); @@ -245,20 +314,181 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { //erase from file list nameFileNames.erase(nameFileNames.begin()+i); i--; + }else { + m->setNameFile(nameFileNames[i]); + } + } + } + } + + if (nameFileNames.size() != 0) { hasName = true; } + + //check for required parameters + vector countfileNames; + countfile = validParameter.validFile(parameters, "count", false); + if (countfile == "not found") { + countfile = ""; + }else { + m->splitAtDash(countfile, countfileNames); + + //go through files and make sure they are good, if not, then disregard them + for (int i = 0; i < countfileNames.size(); i++) { + + bool ignore = false; + if (countfileNames[i] == "current") { + countfileNames[i] = m->getCountTableFile(); + if (nameFileNames[i] != "") { m->mothurOut("Using " + countfileNames[i] + " as input file for the count parameter where you had given current."); m->mothurOutEndLine(); } + else { + m->mothurOut("You have no current count file, ignoring current."); m->mothurOutEndLine(); ignore=true; + //erase from file list + countfileNames.erase(countfileNames.begin()+i); + i--; + } + } + + if (!ignore) { + + if (inputDir != "") { + string path = m->hasPath(countfileNames[i]); + //if the user has not given a path then, add inputdir. else leave path alone. + if (path == "") { countfileNames[i] = inputDir + countfileNames[i]; } + } + + int ableToOpen; + ifstream in; + + ableToOpen = m->openInputFile(countfileNames[i], in, "noerror"); + + //if you can't open it, try default location + if (ableToOpen == 1) { + if (m->getDefaultPath() != "") { //default path is set + string tryPath = m->getDefaultPath() + m->getSimpleName(countfileNames[i]); + m->mothurOut("Unable to open " + countfileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + countfileNames[i] = tryPath; + } + } + + if (ableToOpen == 1) { + if (m->getOutputDir() != "") { //default path is set + string tryPath = m->getOutputDir() + m->getSimpleName(countfileNames[i]); + m->mothurOut("Unable to open " + countfileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + countfileNames[i] = tryPath; + } + } + + in.close(); + + if (ableToOpen == 1) { + m->mothurOut("Unable to open " + countfileNames[i] + ". It will be disregarded."); m->mothurOutEndLine(); + //erase from file list + countfileNames.erase(countfileNames.begin()+i); + i--; + }else { + m->setCountTableFile(countfileNames[i]); + } + } + } + } + + if (countfileNames.size() != 0) { hasCount = true; } + + //make sure there is at least one valid file left + if (hasName && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or name."); m->mothurOutEndLine(); abort = true; } + + if (!hasName && hasCount) { nameFileNames = countfileNames; } + + if ((hasCount || hasName) && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of name or count files does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; } + + bool hasGroup = true; + groupfile = validParameter.validFile(parameters, "group", false); + if (groupfile == "not found") { groupfile = ""; hasGroup = false; } + else { + m->splitAtDash(groupfile, groupFileNames); + + //go through files and make sure they are good, if not, then disregard them + for (int i = 0; i < groupFileNames.size(); i++) { + + bool ignore = false; + if (groupFileNames[i] == "current") { + groupFileNames[i] = m->getGroupFile(); + if (groupFileNames[i] != "") { m->mothurOut("Using " + groupFileNames[i] + " as input file for the group parameter where you had given current."); m->mothurOutEndLine(); } + else { + m->mothurOut("You have no current namefile, ignoring current."); m->mothurOutEndLine(); ignore=true; + //erase from file list + groupFileNames.erase(groupFileNames.begin()+i); + i--; + } + } + + if (!ignore) { + + if (inputDir != "") { + string path = m->hasPath(groupFileNames[i]); + //if the user has not given a path then, add inputdir. else leave path alone. + if (path == "") { groupFileNames[i] = inputDir + groupFileNames[i]; } + } + + int ableToOpen; + ifstream in; + + ableToOpen = m->openInputFile(groupFileNames[i], in, "noerror"); + + //if you can't open it, try default location + if (ableToOpen == 1) { + if (m->getDefaultPath() != "") { //default path is set + string tryPath = m->getDefaultPath() + m->getSimpleName(groupFileNames[i]); + m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying default " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + groupFileNames[i] = tryPath; + } + } + + if (ableToOpen == 1) { + if (m->getOutputDir() != "") { //default path is set + string tryPath = m->getOutputDir() + m->getSimpleName(groupFileNames[i]); + m->mothurOut("Unable to open " + groupFileNames[i] + ". Trying output directory " + tryPath); m->mothurOutEndLine(); + ifstream in2; + ableToOpen = m->openInputFile(tryPath, in2, "noerror"); + in2.close(); + groupFileNames[i] = tryPath; + } + } + + in.close(); + + if (ableToOpen == 1) { + m->mothurOut("Unable to open " + groupFileNames[i] + ". It will be disregarded."); m->mothurOutEndLine(); + //erase from file list + groupFileNames.erase(groupFileNames.begin()+i); + i--; + }else { + m->setGroupFile(groupFileNames[i]); } } } //make sure there is at least one valid file left - if (nameFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid name files."); m->mothurOutEndLine(); abort = true; } + if (groupFileNames.size() == 0) { m->mothurOut("[ERROR]: no valid group files."); m->mothurOutEndLine(); abort = true; } } - if (hasName && (nameFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of namefiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; } + if (hasGroup && (groupFileNames.size() != fastaFileNames.size())) { m->mothurOut("[ERROR]: The number of groupfiles does not match the number of fastafiles, please correct."); m->mothurOutEndLine(); abort=true; } + if (hasGroup && hasCount) { m->mothurOut("[ERROR]: You must enter ONLY ONE of the following: count or group."); m->mothurOutEndLine(); abort = true; } //if the user changes the output directory command factory will send this info to us in the output parameter outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } + //if the user changes the output directory command factory will send this info to us in the output parameter + outputDir = validParameter.validFile(parameters, "outputdir", false); if (outputDir == "not found"){ outputDir = ""; } + string path; it = parameters.find("reference"); //user has given a template file @@ -271,14 +501,124 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { templatefile = validParameter.validFile(parameters, "reference", true); if (templatefile == "not open") { abort = true; } - else if (templatefile == "not found") { templatefile = ""; m->mothurOut("reference is a required parameter for the chimera.slayer command."); m->mothurOutEndLine(); abort = true; } + else if (templatefile == "not found") { //check for saved reference sequences + if (rdb->getSavedReference() != "") { + templatefile = rdb->getSavedReference(); + m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine(); + }else { + m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required."); + m->mothurOutEndLine(); + abort = true; + } + } } + }else if (hasName) { templatefile = "self"; } + else if (hasCount) { templatefile = "self"; } + else { + if (rdb->getSavedReference() != "") { + templatefile = rdb->getSavedReference(); + m->mothurOutEndLine(); m->mothurOut("Using sequences from " + rdb->getSavedReference() + "."); m->mothurOutEndLine(); + }else { + m->mothurOut("[ERROR]: You don't have any saved reference sequences and the reference parameter is a required."); + m->mothurOutEndLine(); + templatefile = ""; abort = true; + } } - + string temp = validParameter.validFile(parameters, "processors", false); if (temp == "not found"){ temp = m->getProcessors(); } m->setProcessors(temp); - convert(temp, processors); - } + m->mothurConvert(temp, processors); + + abskew = validParameter.validFile(parameters, "abskew", false); if (abskew == "not found"){ useAbskew = false; abskew = "1.9"; }else{ useAbskew = true; } + if (useAbskew && templatefile != "self") { m->mothurOut("The abskew parameter is only valid with template=self, ignoring."); m->mothurOutEndLine(); useAbskew = false; } + + temp = validParameter.validFile(parameters, "chimealns", false); if (temp == "not found") { temp = "f"; } + chimealns = m->isTrue(temp); + + minh = validParameter.validFile(parameters, "minh", false); if (minh == "not found") { useMinH = false; minh = "0.3"; } else{ useMinH = true; } + mindiv = validParameter.validFile(parameters, "mindiv", false); if (mindiv == "not found") { useMindiv = false; mindiv = "0.5"; } else{ useMindiv = true; } + xn = validParameter.validFile(parameters, "xn", false); if (xn == "not found") { useXn = false; xn = "8.0"; } else{ useXn = true; } + dn = validParameter.validFile(parameters, "dn", false); if (dn == "not found") { useDn = false; dn = "1.4"; } else{ useDn = true; } + xa = validParameter.validFile(parameters, "xa", false); if (xa == "not found") { useXa = false; xa = "1"; } else{ useXa = true; } + chunks = validParameter.validFile(parameters, "chunks", false); if (chunks == "not found") { useChunks = false; chunks = "4"; } else{ useChunks = true; } + minchunk = validParameter.validFile(parameters, "minchunk", false); if (minchunk == "not found") { useMinchunk = false; minchunk = "64"; } else{ useMinchunk = true; } + idsmoothwindow = validParameter.validFile(parameters, "idsmoothwindow", false); if (idsmoothwindow == "not found") { useIdsmoothwindow = false; idsmoothwindow = "32"; } else{ useIdsmoothwindow = true; } + //minsmoothid = validParameter.validFile(parameters, "minsmoothid", false); if (minsmoothid == "not found") { useMinsmoothid = false; minsmoothid = "0.95"; } else{ useMinsmoothid = true; } + maxp = validParameter.validFile(parameters, "maxp", false); if (maxp == "not found") { useMaxp = false; maxp = "2"; } else{ useMaxp = true; } + minlen = validParameter.validFile(parameters, "minlen", false); if (minlen == "not found") { useMinlen = false; minlen = "10"; } else{ useMinlen = true; } + maxlen = validParameter.validFile(parameters, "maxlen", false); if (maxlen == "not found") { useMaxlen = false; maxlen = "10000"; } else{ useMaxlen = true; } + + strand = validParameter.validFile(parameters, "strand", false); if (strand == "not found") { strand = ""; } + + temp = validParameter.validFile(parameters, "ucl", false); if (temp == "not found") { temp = "f"; } + ucl = m->isTrue(temp); + + queryfract = validParameter.validFile(parameters, "queryfract", false); if (queryfract == "not found") { useQueryfract = false; queryfract = "0.5"; } else{ useQueryfract = true; } + if (!ucl && useQueryfract) { m->mothurOut("queryfact may only be used when ucl=t, ignoring."); m->mothurOutEndLine(); useQueryfract = false; } + + temp = validParameter.validFile(parameters, "skipgaps", false); if (temp == "not found") { temp = "t"; } + skipgaps = m->isTrue(temp); + + temp = validParameter.validFile(parameters, "skipgaps2", false); if (temp == "not found") { temp = "t"; } + skipgaps2 = m->isTrue(temp); + + + temp = validParameter.validFile(parameters, "dereplicate", false); + if (temp == "not found") { temp = "false"; } + dups = m->isTrue(temp); + + + if (hasName && (templatefile != "self")) { m->mothurOut("You have provided a namefile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; } + if (hasCount && (templatefile != "self")) { m->mothurOut("You have provided a countfile and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; } + if (hasGroup && (templatefile != "self")) { m->mothurOut("You have provided a group file and the reference parameter is not set to self. I am not sure what reference you are trying to use, aborting."); m->mothurOutEndLine(); abort=true; } + + //look for uchime exe + path = m->argv; + string tempPath = path; + for (int i = 0; i < path.length(); i++) { tempPath[i] = tolower(path[i]); } + path = path.substr(0, (tempPath.find_last_of('m'))); + + string uchimeCommand; +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) + uchimeCommand = path + "uchime"; // format the database, -o option gives us the ability + if (m->debug) { + m->mothurOut("[DEBUG]: Uchime location using \"which uchime\" = "); + Command* newCommand = new SystemCommand("which uchime"); m->mothurOutEndLine(); + newCommand->execute(); + delete newCommand; + m->mothurOut("[DEBUG]: Mothur's location using \"which mothur\" = "); + newCommand = new SystemCommand("which mothur"); m->mothurOutEndLine(); + newCommand->execute(); + delete newCommand; + } +#else + uchimeCommand = path + "uchime.exe"; +#endif + + //test to make sure uchime exists + ifstream in; + uchimeCommand = m->getFullPathName(uchimeCommand); + int ableToOpen = m->openInputFile(uchimeCommand, in, "no error"); in.close(); + if(ableToOpen == 1) { + m->mothurOut(uchimeCommand + " file does not exist. Checking path... \n"); + //check to see if uchime is in the path?? + + string uLocation = m->findProgramPath("uchime"); + + + ifstream in2; +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) + ableToOpen = m->openInputFile(uLocation, in2, "no error"); in2.close(); +#else + ableToOpen = m->openInputFile((uLocation + ".exe"), in2, "no error"); in2.close(); +#endif + + if(ableToOpen == 1) { m->mothurOut("[ERROR]: " + uLocation + " file does not exist. mothur requires the uchime executable."); m->mothurOutEndLine(); abort = true; } + else { m->mothurOut("Found uchime in your path, using " + uLocation + "\n");uchimeLocation = uLocation; } + }else { uchimeLocation = uchimeCommand; } + + uchimeLocation = m->getFullPathName(uchimeLocation); + } } catch(exception& e) { m->errorOut(e, "ChimeraSlayerCommand", "ChimeraSlayerCommand"); @@ -289,7 +629,10 @@ ChimeraUchimeCommand::ChimeraUchimeCommand(string option) { int ChimeraUchimeCommand::execute(){ try{ - if (abort == true) { if (calledHelp) { return 0; } return 2; } + + if (abort == true) { if (calledHelp) { return 0; } return 2; } + + m->mothurOut("\nuchime by Robert C. Edgar\nhttp://drive5.com/uchime\nThis code is donated to the public domain.\n\n"); for (int s = 0; s < fastaFileNames.size(); s++) { @@ -297,111 +640,189 @@ int ChimeraUchimeCommand::execute(){ int start = time(NULL); string nameFile = ""; - - if (templatefile == "self") { //you want to run slayer with a refernce template - - #ifdef USE_MPI - int pid; - MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are - if (pid == 0) { //you are the root process - #endif + if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it + map variables; + variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])); + string outputFileName = getOutputFileName("chimera", variables); + string accnosFileName = getOutputFileName("accnos", variables); + string alnsFileName = getOutputFileName("alns", variables); + string newFasta = m->getRootName(fastaFileNames[s]) + "temp"; + string newCountFile = ""; + //you provided a groupfile + string groupFile = ""; + bool hasGroup = false; + if (groupFileNames.size() != 0) { groupFile = groupFileNames[s]; hasGroup = true; } + else if (hasCount) { + CountTable ct; + if (ct.testGroups(nameFileNames[s])) { hasGroup = true; } + variables["[filename]"] = outputDir + m->getRootName(m->getSimpleName(nameFileNames[s])); + newCountFile = getOutputFileName("count", variables); + } + + if ((templatefile == "self") && (!hasGroup)) { //you want to run uchime with a template=self and no groups + if (processors != 1) { m->mothurOut("When using template=self, mothur can only use 1 processor, continuing."); m->mothurOutEndLine(); processors = 1; } if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one nameFile = nameFileNames[s]; - }else { - m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine(); - - //use unique.seqs to create new name and fastafile - string inputString = "fasta=" + fastaFileNames[s]; - m->mothurOut("/******************************************/"); m->mothurOutEndLine(); - m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine(); - - Command* uniqueCommand = new DeconvoluteCommand(inputString); - uniqueCommand->execute(); - - map > filenames = uniqueCommand->getOutputFiles(); - - delete uniqueCommand; - - m->mothurOut("/******************************************/"); m->mothurOutEndLine(); - - nameFile = filenames["name"][0]; - fastaFileNames[s] = filenames["fasta"][0]; - } - - //create input file for uchime - //read through fastafile and store info - map seqs; - ifstream in; - m->openInputFile(fastaFileNames[s], in); - - while (!in.eof()) { - - if (m->control_pressed) { in.close(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } - - Sequence seq(in); m->gobble(in); - seqs[seq.getName()] = seq.getAligned(); - } - in.close(); - + }else { nameFile = getNamesFile(fastaFileNames[s]); } + + map seqs; + readFasta(fastaFileNames[s], seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + //read namefile vector nameMapCount; - int error = m->readNames(nameFile, nameMapCount, seqs); + int error; + if (hasCount) { + CountTable ct; + ct.readTable(nameFile, true, false); + for(map::iterator it = seqs.begin(); it != seqs.end(); it++) { + int num = ct.getNumSeqs(it->first); + if (num == 0) { error = 1; } + else { + seqPriorityNode temp(num, it->second, it->first); + nameMapCount.push_back(temp); + } + } + }else { + error = m->readNames(nameFile, nameMapCount, seqs); if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + } + if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } + printFile(nameMapCount, newFasta); + fastaFileNames[s] = newFasta; + } + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + if (hasGroup) { + if (nameFileNames.size() != 0) { //you provided a namefile and we don't need to create one + nameFile = nameFileNames[s]; + }else { nameFile = getNamesFile(fastaFileNames[s]); } - if (error == 1) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } - if (seqs.size() != nameMapCount.size()) { m->mothurOut( "The number of sequences in your fastafile does not match the number of sequences in your namefile, aborting."); m->mothurOutEndLine(); for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } + //Parse sequences by group + vector groups; + map uniqueNames; + if (hasCount) { + cparser = new SequenceCountParser(nameFile, fastaFileNames[s]); + groups = cparser->getNamesOfGroups(); + uniqueNames = cparser->getAllSeqsMap(); + }else{ + sparser = new SequenceParser(groupFile, fastaFileNames[s], nameFile); + groups = sparser->getNamesOfGroups(); + uniqueNames = sparser->getAllSeqsMap(); + } + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + //clears files + ofstream out, out1, out2; + m->openOutputFile(outputFileName, out); out.close(); + m->openOutputFile(accnosFileName, out1); out1.close(); + if (chimealns) { m->openOutputFile(alnsFileName, out2); out2.close(); } + int totalSeqs = 0; - sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes); + if(processors == 1) { totalSeqs = driverGroups(outputFileName, newFasta, accnosFileName, alnsFileName, newCountFile, 0, groups.size(), groups); + + if (hasCount && dups) { + CountTable c; c.readTable(nameFile, true, false); + if (!m->isBlank(newCountFile)) { + ifstream in2; + m->openInputFile(newCountFile, in2); + + string name, group; + while (!in2.eof()) { + in2 >> name >> group; m->gobble(in2); + c.setAbund(name, group, 0); + } + in2.close(); + } + m->mothurRemove(newCountFile); + c.printTable(newCountFile); + } + + }else { totalSeqs = createProcessesGroups(outputFileName, newFasta, accnosFileName, alnsFileName, newCountFile, groups, nameFile, groupFile, fastaFileNames[s]); } + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + + if (!dups) { + int totalChimeras = deconvoluteResults(uniqueNames, outputFileName, accnosFileName, alnsFileName); - string newFasta = fastaFileNames[s] + ".temp"; - ofstream out; - m->openOutputFile(newFasta, out); + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(totalSeqs) + " sequences. " + toString(totalChimeras) + " chimeras were found."); m->mothurOutEndLine(); + m->mothurOut("The number of sequences checked may be larger than the number of unique sequences because some sequences are found in several samples."); m->mothurOutEndLine(); + }else { + + if (hasCount) { + set doNotRemove; + CountTable c; c.readTable(newCountFile, true, true); + vector namesInTable = c.getNamesOfSeqs(); + for (int i = 0; i < namesInTable.size(); i++) { + int temp = c.getNumSeqs(namesInTable[i]); + if (temp == 0) { c.remove(namesInTable[i]); } + else { doNotRemove.insert((namesInTable[i])); } + } + //remove names we want to keep from accnos file. + set accnosNames = m->readAccnos(accnosFileName); + ofstream out2; + m->openOutputFile(accnosFileName, out2); + for (set::iterator it = accnosNames.begin(); it != accnosNames.end(); it++) { + if (doNotRemove.count(*it) == 0) { out2 << (*it) << endl; } + } + out2.close(); + c.printTable(newCountFile); + outputNames.push_back(newCountFile); outputTypes["count"].push_back(newCountFile); + } + } + + if (hasCount) { delete cparser; } + else { delete sparser; } + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + }else{ + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } + + int numSeqs = 0; + int numChimeras = 0; + + if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); } + else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName, alnsFileName, numChimeras); } - //print new file in order of - for (int i = 0; i < nameMapCount.size(); i++) { - out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl; - } + //add headings + ofstream out; + m->openOutputFile(outputFileName+".temp", out); + out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n"; out.close(); - fastaFileNames[s] = newFasta; - - #ifdef USE_MPI - } - #endif - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } - } - - if (outputDir == "") { outputDir = m->hasPath(fastaFileNames[s]); }//if user entered a file with a path then preserve it - string outputFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "slayer.chimera"; - string accnosFileName = outputDir + m->getRootName(m->getSimpleName(fastaFileNames[s])) + "slayer.accnos"; + m->appendFiles(outputFileName, outputFileName+".temp"); + m->mothurRemove(outputFileName); rename((outputFileName+".temp").c_str(), outputFileName.c_str()); + + if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { m->mothurRemove(outputNames[j]); } return 0; } - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } + //remove file made for uchime + if (templatefile == "self") { m->mothurRemove(fastaFileNames[s]); } - int numSeqs = 0; -#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) - if(processors == 1){ numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName); } - else{ numSeqs = createProcesses(outputFileName, fastaFileNames[s], accnosFileName); } -#else - numSeqs = driver(outputFileName, fastaFileNames[s], accnosFileName); -#endif - if (m->control_pressed) { for (int j = 0; j < outputNames.size(); j++) { remove(outputNames[j].c_str()); } return 0; } - + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences. " + toString(numChimeras) + " chimeras were found."); m->mothurOutEndLine(); + } outputNames.push_back(outputFileName); outputTypes["chimera"].push_back(outputFileName); outputNames.push_back(accnosFileName); outputTypes["accnos"].push_back(accnosFileName); - - m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences."); m->mothurOutEndLine(); + if (chimealns) { outputNames.push_back(alnsFileName); outputTypes["alns"].push_back(alnsFileName); } } - + //set accnos file as new current accnosfile string current = ""; itTypes = outputTypes.find("accnos"); if (itTypes != outputTypes.end()) { if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setAccnosFile(current); } } + + itTypes = outputTypes.find("count"); + if (itTypes != outputTypes.end()) { + if ((itTypes->second).size() != 0) { current = (itTypes->second)[0]; m->setCountTableFile(current); } + } m->mothurOutEndLine(); m->mothurOut("Output File Names: "); m->mothurOutEndLine(); @@ -417,53 +838,708 @@ int ChimeraUchimeCommand::execute(){ } } //********************************************************************************************************************** +int ChimeraUchimeCommand::deconvoluteResults(map& uniqueNames, string outputFileName, string accnosFileName, string alnsFileName){ + try { + map::iterator itUnique; + int total = 0; + + ofstream out2; + m->openOutputFile(accnosFileName+".temp", out2); + + string name; + set namesInFile; //this is so if a sequence is found to be chimera in several samples we dont write it to the results file more than once + set::iterator itNames; + set chimerasInFile; + set::iterator itChimeras; -int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos){ + if (!m->isBlank(accnosFileName)) { + //edit accnos file + ifstream in2; + m->openInputFile(accnosFileName, in2); + + while (!in2.eof()) { + if (m->control_pressed) { in2.close(); out2.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName+".temp")); return 0; } + + in2 >> name; m->gobble(in2); + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing accnos results. Cannot find " + name + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + itChimeras = chimerasInFile.find((itUnique->second)); + + if (itChimeras == chimerasInFile.end()) { + out2 << itUnique->second << endl; + chimerasInFile.insert((itUnique->second)); + total++; + } + } + } + in2.close(); + } + out2.close(); + + m->mothurRemove(accnosFileName); + rename((accnosFileName+".temp").c_str(), accnosFileName.c_str()); + + + + //edit chimera file + ifstream in; + m->openInputFile(outputFileName, in); + + ofstream out; + m->openOutputFile(outputFileName+".temp", out); out.setf(ios::fixed, ios::floatfield); out.setf(ios::showpoint); + out << "Score\tQuery\tParentA\tParentB\tIdQM\tIdQA\tIdQB\tIdAB\tIdQT\tLY\tLN\tLA\tRY\tRN\tRA\tDiv\tYN\n"; + + float temp1; + string parent1, parent2, temp2, temp3, temp4, temp5, temp6, temp7, temp8, temp9, temp10, temp11, temp12, temp13, flag; + name = ""; + namesInFile.clear(); + //assumptions - in file each read will always look like - if uchime source is updated, revisit this code. + /* 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 + 0.000000 F11Fcsw_33372/ab=18/ * * * * * * * * * * * * * * N + 0.018300 F11Fcsw_14980/ab=16/ F11Fcsw_1915/ab=35/ F11Fcsw_6032/ab=42/ 79.9 78.7 78.2 78.7 79.2 3 0 5 11 10 20 1.46 N + */ + + while (!in.eof()) { + + if (m->control_pressed) { in.close(); out.close(); m->mothurRemove((outputFileName+".temp")); return 0; } + + bool print = false; + in >> temp1; m->gobble(in); + in >> name; m->gobble(in); + in >> parent1; m->gobble(in); + in >> parent2; m->gobble(in); + in >> temp2 >> temp3 >> temp4 >> temp5 >> temp6 >> temp7 >> temp8 >> temp9 >> temp10 >> temp11 >> temp12 >> temp13 >> flag; + m->gobble(in); + + //parse name - name will look like U68590/ab=1/ + string restOfName = ""; + int pos = name.find_first_of('/'); + if (pos != string::npos) { + restOfName = name.substr(pos); + name = name.substr(0, pos); + } + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find "+ name + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + name = itUnique->second; + //is this name already in the file + itNames = namesInFile.find((name)); + + if (itNames == namesInFile.end()) { //no not in file + if (flag == "N") { //are you really a no?? + //is this sequence really not chimeric?? + itChimeras = chimerasInFile.find(name); + + //then you really are a no so print, otherwise skip + if (itChimeras == chimerasInFile.end()) { print = true; } + }else{ print = true; } + } + } + + if (print) { + out << temp1 << '\t' << name << restOfName << '\t'; + namesInFile.insert(name); + + //parse parent1 names + if (parent1 != "*") { + restOfName = ""; + pos = parent1.find_first_of('/'); + if (pos != string::npos) { + restOfName = parent1.substr(pos); + parent1 = parent1.substr(0, pos); + } + + itUnique = uniqueNames.find(parent1); + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentA "+ parent1 + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { out << itUnique->second << restOfName << '\t'; } + }else { out << parent1 << '\t'; } + + //parse parent2 names + if (parent2 != "*") { + restOfName = ""; + pos = parent2.find_first_of('/'); + if (pos != string::npos) { + restOfName = parent2.substr(pos); + parent2 = parent2.substr(0, pos); + } + + itUnique = uniqueNames.find(parent2); + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing chimera results. Cannot find parentB "+ parent2 + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { out << itUnique->second << restOfName << '\t'; } + }else { out << parent2 << '\t'; } + + out << temp2 << '\t' << temp3 << '\t' << temp4 << '\t' << temp5 << '\t' << temp6 << '\t' << temp7 << '\t' << temp8 << '\t' << temp9 << '\t' << temp10 << '\t' << temp11 << '\t' << temp12 << temp13 << '\t' << flag << endl; + } + } + in.close(); + out.close(); + + m->mothurRemove(outputFileName); + rename((outputFileName+".temp").c_str(), outputFileName.c_str()); + + + //edit anls file + //assumptions - in file each read will always look like - if uchime source is updated, revisit this code. + /* + ------------------------------------------------------------------------ + Query ( 179 nt) F21Fcsw_11639/ab=591/ + ParentA ( 179 nt) F11Fcsw_6529/ab=1625/ + ParentB ( 181 nt) F21Fcsw_12128/ab=1827/ + + A 1 AAGgAAGAtTAATACaagATGgCaTCatgAGtccgCATgTtcAcatGATTAAAG--gTaTtcCGGTagacGATGGGGATG 78 + Q 1 AAGTAAGACTAATACCCAATGACGTCTCTAGAAGACATCTGAAAGAGATTAAAG--ATTTATCGGTGATGGATGGGGATG 78 + B 1 AAGgAAGAtTAATcCaggATGggaTCatgAGttcACATgTccgcatGATTAAAGgtATTTtcCGGTagacGATGGGGATG 80 + Diffs N N A N?N N N NNN N?NB N ?NaNNN B B NN NNNN + Votes 0 0 + 000 0 0 000 000+ 0 00!000 + 00 0000 + Model AAAAAAAAAAAAAAAAAAAAAAxBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB + + A 79 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCttCGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158 + Q 79 CGTCTGATTAGCTTGTTGGCGGGGTAACGGCCCACCAAGGCAACGATCAGTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 158 + B 81 CGTtccATTAGaTaGTaGGCGGGGTAACGGCCCACCtAGtCAACGATggaTAGGGGTTCTGAGAGGAAGGTCCCCCACAT 160 + Diffs NNN N N N N N BB NNN + Votes 000 0 0 0 0 0 ++ 000 + Model BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB + + A 159 TGGAACTGAGACACGGTCCAA 179 + Q 159 TGGAACTGAGACACGGTCCAA 179 + B 161 TGGAACTGAGACACGGTCCAA 181 + Diffs + Votes + Model BBBBBBBBBBBBBBBBBBBBB + + Ids. QA 76.6%, QB 77.7%, AB 93.7%, QModel 78.9%, Div. +1.5% + Diffs Left 7: N 0, A 6, Y 1 (14.3%); Right 35: N 1, A 30, Y 4 (11.4%), Score 0.0047 + */ + if (chimealns) { + ifstream in3; + m->openInputFile(alnsFileName, in3); + + ofstream out3; + m->openOutputFile(alnsFileName+".temp", out3); out3.setf(ios::fixed, ios::floatfield); out3.setf(ios::showpoint); + + name = ""; + namesInFile.clear(); + string line = ""; + + while (!in3.eof()) { + if (m->control_pressed) { in3.close(); out3.close(); m->mothurRemove(outputFileName); m->mothurRemove((accnosFileName)); m->mothurRemove((alnsFileName+".temp")); return 0; } + + line = ""; + line = m->getline(in3); + string temp = ""; + + if (line != "") { + istringstream iss(line); + iss >> temp; + + //are you a name line + if ((temp == "Query") || (temp == "ParentA") || (temp == "ParentB")) { + int spot = 0; + for (int i = 0; i < line.length(); i++) { + spot = i; + if (line[i] == ')') { break; } + else { out3 << line[i]; } + } + + if (spot == (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else if ((spot+2) > (line.length() - 1)) { m->mothurOut("[ERROR]: could not line sequence name in line " + line + "."); m->mothurOutEndLine(); m->control_pressed = true; } + else { + out << line[spot] << line[spot+1]; + + name = line.substr(spot+2); + + //parse name - name will either look like U68590/ab=1/ or U68590 + string restOfName = ""; + int pos = name.find_first_of('/'); + if (pos != string::npos) { + restOfName = name.substr(pos); + name = name.substr(0, pos); + } + + //find unique name + itUnique = uniqueNames.find(name); + + if (itUnique == uniqueNames.end()) { m->mothurOut("[ERROR]: trouble parsing alns results. Cannot find "+ name + "."); m->mothurOutEndLine();m->control_pressed = true; } + else { + //only limit repeats on query names + if (temp == "Query") { + itNames = namesInFile.find((itUnique->second)); + + if (itNames == namesInFile.end()) { + out << itUnique->second << restOfName << endl; + namesInFile.insert((itUnique->second)); + } + }else { out << itUnique->second << restOfName << endl; } + } + + } + + }else { //not need to alter line + out3 << line << endl; + } + }else { out3 << endl; } + } + in3.close(); + out3.close(); + + m->mothurRemove(alnsFileName); + rename((alnsFileName+".temp").c_str(), alnsFileName.c_str()); + } + + return total; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "deconvoluteResults"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::printFile(vector& nameMapCount, string filename){ + try { + + sort(nameMapCount.begin(), nameMapCount.end(), compareSeqPriorityNodes); + + ofstream out; + m->openOutputFile(filename, out); + + //print new file in order of + for (int i = 0; i < nameMapCount.size(); i++) { + out << ">" << nameMapCount[i].name << "/ab=" << nameMapCount[i].numIdentical << "/" << endl << nameMapCount[i].seq << endl; + } + out.close(); + + return 0; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "printFile"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::readFasta(string filename, map& seqs){ + try { + //create input file for uchime + //read through fastafile and store info + ifstream in; + m->openInputFile(filename, in); + + while (!in.eof()) { + + if (m->control_pressed) { in.close(); return 0; } + + Sequence seq(in); m->gobble(in); + seqs[seq.getName()] = seq.getAligned(); + } + in.close(); + + return 0; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "readFasta"); + exit(1); + } +} +//********************************************************************************************************************** + +string ChimeraUchimeCommand::getNamesFile(string& inputFile){ + try { + string nameFile = ""; + + m->mothurOutEndLine(); m->mothurOut("No namesfile given, running unique.seqs command to generate one."); m->mothurOutEndLine(); m->mothurOutEndLine(); + + //use unique.seqs to create new name and fastafile + string inputString = "fasta=" + inputFile; + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + m->mothurOut("Running command: unique.seqs(" + inputString + ")"); m->mothurOutEndLine(); + m->mothurCalling = true; + + Command* uniqueCommand = new DeconvoluteCommand(inputString); + uniqueCommand->execute(); + + map > filenames = uniqueCommand->getOutputFiles(); + + delete uniqueCommand; + m->mothurCalling = false; + m->mothurOut("/******************************************/"); m->mothurOutEndLine(); + + nameFile = filenames["name"][0]; + inputFile = filenames["fasta"][0]; + + return nameFile; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "getNamesFile"); + exit(1); + } +} +//********************************************************************************************************************** +int ChimeraUchimeCommand::driverGroups(string outputFName, string filename, string accnos, string alns, string countlist, int start, int end, vector groups){ + try { + + int totalSeqs = 0; + int numChimeras = 0; + + + ofstream outCountList; + if (hasCount && dups) { m->openOutputFile(countlist, outCountList); } + + for (int i = start; i < end; i++) { + int start = time(NULL); if (m->control_pressed) { outCountList.close(); m->mothurRemove(countlist); return 0; } + + int error; + if (hasCount) { error = cparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } } + else { error = sparser->getSeqs(groups[i], filename, true); if ((error == 1) || m->control_pressed) { return 0; } } + + int numSeqs = driver((outputFName + groups[i]), filename, (accnos+groups[i]), (alns+ groups[i]), numChimeras); + totalSeqs += numSeqs; + + if (m->control_pressed) { return 0; } + + //remove file made for uchime + if (!m->debug) { m->mothurRemove(filename); } + else { m->mothurOut("[DEBUG]: saving file: " + filename + ".\n"); } + + //if we provided a count file with group info and set dereplicate=t, then we want to create a *.pick.count_table + //This table will zero out group counts for seqs determined to be chimeric by that group. + if (dups) { + if (!m->isBlank(accnos+groups[i])) { + ifstream in; + m->openInputFile(accnos+groups[i], in); + string name; + if (hasCount) { + while (!in.eof()) { + in >> name; m->gobble(in); + outCountList << name << '\t' << groups[i] << endl; + } + in.close(); + }else { + map thisnamemap = sparser->getNameMap(groups[i]); + map::iterator itN; + ofstream out; + m->openOutputFile(accnos+groups[i]+".temp", out); + while (!in.eof()) { + in >> name; m->gobble(in); + itN = thisnamemap.find(name); + if (itN != thisnamemap.end()) { + vector tempNames; m->splitAtComma(itN->second, tempNames); + for (int j = 0; j < tempNames.size(); j++) { out << tempNames[j] << endl; } + + }else { m->mothurOut("[ERROR]: parsing cannot find " + name + ".\n"); m->control_pressed = true; } + } + out.close(); + in.close(); + m->renameFile(accnos+groups[i]+".temp", accnos+groups[i]); + } + + } + } + + //append files + m->appendFiles((outputFName+groups[i]), outputFName); m->mothurRemove((outputFName+groups[i])); + m->appendFiles((accnos+groups[i]), accnos); m->mothurRemove((accnos+groups[i])); + if (chimealns) { m->appendFiles((alns+groups[i]), alns); m->mothurRemove((alns+groups[i])); } + + m->mothurOutEndLine(); m->mothurOut("It took " + toString(time(NULL) - start) + " secs to check " + toString(numSeqs) + " sequences from group " + groups[i] + "."); m->mothurOutEndLine(); + } + + if (hasCount && dups) { outCountList.close(); } + + return totalSeqs; + + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "driverGroups"); + exit(1); + } +} +//********************************************************************************************************************** + +int ChimeraUchimeCommand::driver(string outputFName, string filename, string accnos, string alns, int& numChimeras){ try { + outputFName = m->getFullPathName(outputFName); + filename = m->getFullPathName(filename); + alns = m->getFullPathName(alns); + + //to allow for spaces in the path + outputFName = "\"" + outputFName + "\""; + filename = "\"" + filename + "\""; + alns = "\"" + alns + "\""; + vector cPara; - char* tempUchime = new char[8]; - strcpy(tempUchime, "./uchime "); + string uchimeCommand = uchimeLocation; + uchimeCommand = "\"" + uchimeCommand + "\" "; + + char* tempUchime; + tempUchime= new char[uchimeCommand.length()+1]; + *tempUchime = '\0'; + strncat(tempUchime, uchimeCommand.c_str(), uchimeCommand.length()); cPara.push_back(tempUchime); - char* tempIn = new char[7]; - strcpy(tempIn, "--input"); - cPara.push_back(tempIn); - char* temp = new char[filename.length()]; - strcpy(temp, filename.c_str()); - cPara.push_back(temp); - - //are you using a reference file + //are you using a reference file if (templatefile != "self") { - + string outputFileName = filename.substr(1, filename.length()-2) + ".uchime_formatted"; + prepFile(filename.substr(1, filename.length()-2), outputFileName); + filename = outputFileName; + filename = "\"" + filename + "\""; //add reference file - char* tempRef = new char[4]; - strcpy(tempRef, "--db"); + char* tempRef = new char[5]; + //strcpy(tempRef, "--db"); + *tempRef = '\0'; strncat(tempRef, "--db", 4); cPara.push_back(tempRef); - char* tempR = new char[templatefile.length()]; - strcpy(tempR, templatefile.c_str()); + char* tempR = new char[templatefile.length()+1]; + //strcpy(tempR, templatefile.c_str()); + *tempR = '\0'; strncat(tempR, templatefile.c_str(), templatefile.length()); cPara.push_back(tempR); } - char* tempO = new char[11]; - strcpy(tempO, "--uchimeout"); + char* tempIn = new char[8]; + *tempIn = '\0'; strncat(tempIn, "--input", 7); + //strcpy(tempIn, "--input"); + cPara.push_back(tempIn); + char* temp = new char[filename.length()+1]; + *temp = '\0'; strncat(temp, filename.c_str(), filename.length()); + //strcpy(temp, filename.c_str()); + cPara.push_back(temp); + + char* tempO = new char[12]; + *tempO = '\0'; strncat(tempO, "--uchimeout", 11); + //strcpy(tempO, "--uchimeout"); cPara.push_back(tempO); - char* tempout = new char[outputFName.length()]; - strcpy(tempout, outputFName.c_str()); + char* tempout = new char[outputFName.length()+1]; + //strcpy(tempout, outputFName.c_str()); + *tempout = '\0'; strncat(tempout, outputFName.c_str(), outputFName.length()); cPara.push_back(tempout); + if (chimealns) { + char* tempA = new char[13]; + *tempA = '\0'; strncat(tempA, "--uchimealns", 12); + //strcpy(tempA, "--uchimealns"); + cPara.push_back(tempA); + char* tempa = new char[alns.length()+1]; + //strcpy(tempa, alns.c_str()); + *tempa = '\0'; strncat(tempa, alns.c_str(), alns.length()); + cPara.push_back(tempa); + } + + if (strand != "") { + char* tempA = new char[9]; + *tempA = '\0'; strncat(tempA, "--strand", 8); + cPara.push_back(tempA); + char* tempa = new char[strand.length()+1]; + *tempa = '\0'; strncat(tempa, strand.c_str(), strand.length()); + cPara.push_back(tempa); + } + + if (useAbskew) { + char* tempskew = new char[9]; + *tempskew = '\0'; strncat(tempskew, "--abskew", 8); + //strcpy(tempskew, "--abskew"); + cPara.push_back(tempskew); + char* tempSkew = new char[abskew.length()+1]; + //strcpy(tempSkew, abskew.c_str()); + *tempSkew = '\0'; strncat(tempSkew, abskew.c_str(), abskew.length()); + cPara.push_back(tempSkew); + } + + if (useMinH) { + char* tempminh = new char[7]; + *tempminh = '\0'; strncat(tempminh, "--minh", 6); + //strcpy(tempminh, "--minh"); + cPara.push_back(tempminh); + char* tempMinH = new char[minh.length()+1]; + *tempMinH = '\0'; strncat(tempMinH, minh.c_str(), minh.length()); + //strcpy(tempMinH, minh.c_str()); + cPara.push_back(tempMinH); + } + + if (useMindiv) { + char* tempmindiv = new char[9]; + *tempmindiv = '\0'; strncat(tempmindiv, "--mindiv", 8); + //strcpy(tempmindiv, "--mindiv"); + cPara.push_back(tempmindiv); + char* tempMindiv = new char[mindiv.length()+1]; + *tempMindiv = '\0'; strncat(tempMindiv, mindiv.c_str(), mindiv.length()); + //strcpy(tempMindiv, mindiv.c_str()); + cPara.push_back(tempMindiv); + } + + if (useXn) { + char* tempxn = new char[5]; + //strcpy(tempxn, "--xn"); + *tempxn = '\0'; strncat(tempxn, "--xn", 4); + cPara.push_back(tempxn); + char* tempXn = new char[xn.length()+1]; + //strcpy(tempXn, xn.c_str()); + *tempXn = '\0'; strncat(tempXn, xn.c_str(), xn.length()); + cPara.push_back(tempXn); + } + + if (useDn) { + char* tempdn = new char[5]; + //strcpy(tempdn, "--dn"); + *tempdn = '\0'; strncat(tempdn, "--dn", 4); + cPara.push_back(tempdn); + char* tempDn = new char[dn.length()+1]; + *tempDn = '\0'; strncat(tempDn, dn.c_str(), dn.length()); + //strcpy(tempDn, dn.c_str()); + cPara.push_back(tempDn); + } + + if (useXa) { + char* tempxa = new char[5]; + //strcpy(tempxa, "--xa"); + *tempxa = '\0'; strncat(tempxa, "--xa", 4); + cPara.push_back(tempxa); + char* tempXa = new char[xa.length()+1]; + *tempXa = '\0'; strncat(tempXa, xa.c_str(), xa.length()); + //strcpy(tempXa, xa.c_str()); + cPara.push_back(tempXa); + } + + if (useChunks) { + char* tempchunks = new char[9]; + //strcpy(tempchunks, "--chunks"); + *tempchunks = '\0'; strncat(tempchunks, "--chunks", 8); + cPara.push_back(tempchunks); + char* tempChunks = new char[chunks.length()+1]; + *tempChunks = '\0'; strncat(tempChunks, chunks.c_str(), chunks.length()); + //strcpy(tempChunks, chunks.c_str()); + cPara.push_back(tempChunks); + } + + if (useMinchunk) { + char* tempminchunk = new char[11]; + //strcpy(tempminchunk, "--minchunk"); + *tempminchunk = '\0'; strncat(tempminchunk, "--minchunk", 10); + cPara.push_back(tempminchunk); + char* tempMinchunk = new char[minchunk.length()+1]; + *tempMinchunk = '\0'; strncat(tempMinchunk, minchunk.c_str(), minchunk.length()); + //strcpy(tempMinchunk, minchunk.c_str()); + cPara.push_back(tempMinchunk); + } + + if (useIdsmoothwindow) { + char* tempidsmoothwindow = new char[17]; + *tempidsmoothwindow = '\0'; strncat(tempidsmoothwindow, "--idsmoothwindow", 16); + //strcpy(tempidsmoothwindow, "--idsmoothwindow"); + cPara.push_back(tempidsmoothwindow); + char* tempIdsmoothwindow = new char[idsmoothwindow.length()+1]; + *tempIdsmoothwindow = '\0'; strncat(tempIdsmoothwindow, idsmoothwindow.c_str(), idsmoothwindow.length()); + //strcpy(tempIdsmoothwindow, idsmoothwindow.c_str()); + cPara.push_back(tempIdsmoothwindow); + } + + /*if (useMinsmoothid) { + char* tempminsmoothid = new char[14]; + //strcpy(tempminsmoothid, "--minsmoothid"); + *tempminsmoothid = '\0'; strncat(tempminsmoothid, "--minsmoothid", 13); + cPara.push_back(tempminsmoothid); + char* tempMinsmoothid = new char[minsmoothid.length()+1]; + *tempMinsmoothid = '\0'; strncat(tempMinsmoothid, minsmoothid.c_str(), minsmoothid.length()); + //strcpy(tempMinsmoothid, minsmoothid.c_str()); + cPara.push_back(tempMinsmoothid); + }*/ + + if (useMaxp) { + char* tempmaxp = new char[7]; + //strcpy(tempmaxp, "--maxp"); + *tempmaxp = '\0'; strncat(tempmaxp, "--maxp", 6); + cPara.push_back(tempmaxp); + char* tempMaxp = new char[maxp.length()+1]; + *tempMaxp = '\0'; strncat(tempMaxp, maxp.c_str(), maxp.length()); + //strcpy(tempMaxp, maxp.c_str()); + cPara.push_back(tempMaxp); + } + + if (!skipgaps) { + char* tempskipgaps = new char[13]; + //strcpy(tempskipgaps, "--[no]skipgaps"); + *tempskipgaps = '\0'; strncat(tempskipgaps, "--noskipgaps", 12); + cPara.push_back(tempskipgaps); + } + + if (!skipgaps2) { + char* tempskipgaps2 = new char[14]; + //strcpy(tempskipgaps2, "--[no]skipgaps2"); + *tempskipgaps2 = '\0'; strncat(tempskipgaps2, "--noskipgaps2", 13); + cPara.push_back(tempskipgaps2); + } + + if (useMinlen) { + char* tempminlen = new char[9]; + *tempminlen = '\0'; strncat(tempminlen, "--minlen", 8); + //strcpy(tempminlen, "--minlen"); + cPara.push_back(tempminlen); + char* tempMinlen = new char[minlen.length()+1]; + //strcpy(tempMinlen, minlen.c_str()); + *tempMinlen = '\0'; strncat(tempMinlen, minlen.c_str(), minlen.length()); + cPara.push_back(tempMinlen); + } + + if (useMaxlen) { + char* tempmaxlen = new char[9]; + //strcpy(tempmaxlen, "--maxlen"); + *tempmaxlen = '\0'; strncat(tempmaxlen, "--maxlen", 8); + cPara.push_back(tempmaxlen); + char* tempMaxlen = new char[maxlen.length()+1]; + *tempMaxlen = '\0'; strncat(tempMaxlen, maxlen.c_str(), maxlen.length()); + //strcpy(tempMaxlen, maxlen.c_str()); + cPara.push_back(tempMaxlen); + } + + if (ucl) { + char* tempucl = new char[5]; + strcpy(tempucl, "--ucl"); + cPara.push_back(tempucl); + } + + if (useQueryfract) { + char* tempqueryfract = new char[13]; + *tempqueryfract = '\0'; strncat(tempqueryfract, "--queryfract", 12); + //strcpy(tempqueryfract, "--queryfract"); + cPara.push_back(tempqueryfract); + char* tempQueryfract = new char[queryfract.length()+1]; + *tempQueryfract = '\0'; strncat(tempQueryfract, queryfract.c_str(), queryfract.length()); + //strcpy(tempQueryfract, queryfract.c_str()); + cPara.push_back(tempQueryfract); + } + + char** uchimeParameters; uchimeParameters = new char*[cPara.size()]; - for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; } - int numArgs = cPara.size(); + string commandString = ""; + for (int i = 0; i < cPara.size(); i++) { uchimeParameters[i] = cPara[i]; commandString += toString(cPara[i]) + " "; } + //int numArgs = cPara.size(); - uchime_main(numArgs, uchimeParameters); + //uchime_main(numArgs, uchimeParameters); + //cout << "commandString = " << commandString << endl; +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) +#else + commandString = "\"" + commandString + "\""; +#endif + if (m->debug) { m->mothurOut("[DEBUG]: uchime command = " + commandString + ".\n"); } + system(commandString.c_str()); //free memory - for(int i = 0; i < cPara.size(); i++) { delete[] cPara[i]; } + for(int i = 0; i < cPara.size(); i++) { delete cPara[i]; } delete[] uchimeParameters; + //remove "" from filenames + outputFName = outputFName.substr(1, outputFName.length()-2); + filename = filename.substr(1, filename.length()-2); + alns = alns.substr(1, alns.length()-2); + + if (m->control_pressed) { return 0; } + //create accnos file from uchime results ifstream in; m->openInputFile(outputFName, in); @@ -472,29 +1548,38 @@ int ChimeraUchimeCommand::driver(string outputFName, string filename, string acc m->openOutputFile(accnos, out); int num = 0; + numChimeras = 0; while(!in.eof()) { if (m->control_pressed) { break; } string name = ""; string chimeraFlag = ""; - in >> chimeraFlag >> name; + //in >> chimeraFlag >> name; - //fix name if needed - if (templatefile != "self") { - name = name.substr(0, name.length()-1); //rip off last / - name = name.substr(0, name.find_last_of('/')); + string line = m->getline(in); + vector pieces = m->splitWhiteSpace(line); + if (pieces.size() > 2) { + name = pieces[1]; + //fix name if needed + if (templatefile == "self") { + name = name.substr(0, name.length()-1); //rip off last / + name = name.substr(0, name.find_last_of('/')); + } + + chimeraFlag = pieces[pieces.size()-1]; } - - for (int i = 0; i < 15; i++) { in >> chimeraFlag; } + //for (int i = 0; i < 15; i++) { in >> chimeraFlag; } m->gobble(in); - if (chimeraFlag == "Y") { out << name << endl; } + if (chimeraFlag == "Y") { out << name << endl; numChimeras++; } num++; } in.close(); out.close(); + //if (templatefile != "self") { m->mothurRemove(filename); } + return num; } catch(exception& e) { @@ -503,57 +1588,49 @@ int ChimeraUchimeCommand::driver(string outputFName, string filename, string acc } } /**************************************************************************************************/ +//uchime can't handle some of the things allowed in mothurs fasta files. This functions "cleans up" the file. +int ChimeraUchimeCommand::prepFile(string filename, string output) { + try { + + ifstream in; + m->openInputFile(filename, in); + + ofstream out; + m->openOutputFile(output, out); + + while (!in.eof()) { + if (m->control_pressed) { break; } + + Sequence seq(in); m->gobble(in); + + if (seq.getName() != "") { seq.printSequence(out); } + } + in.close(); + out.close(); + + return 0; + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "prepFile"); + exit(1); + } +} +/**************************************************************************************************/ -int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos) { +int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename, string accnos, string alns, int& numChimeras) { try { processIDS.clear(); int process = 1; int num = 0; + vector files; +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) //break up file into multiple files - vector files; m->divideFile(filename, processors, files); if (m->control_pressed) { return 0; } - -#ifdef USE_MPI - int pid, numSeqsPerProcessor; - int tag = 2001; - - MPI_Status status; - MPI_Comm_rank(MPI_COMM_WORLD, &pid); //find out who we are - MPI_Comm_size(MPI_COMM_WORLD, &processors); - - if (pid == 0) { //you are the root process - num = driver(outputFileName, files[0], accnos); - - if (templatefile != "self") { - //wait on chidren - for(int j = 1; j < processors; j++) { - int temp; - MPI_Recv(&temp, 1, MPI_INT, j, tag, MPI_COMM_WORLD, &status); - num += temp; - - m->appendFiles((outputFileName + toString(j) + ".temp"), outputFileName); - remove((outputFileName + toString(j) + ".temp").c_str()); - - m->appendFiles((accnos + toString(j) + ".temp"), accnos); - remove((accnos + toString(j) + ".temp").c_str()); - } - } - }else{ //you are a child process - if (templatefile != "self") { //if template=self we can only use 1 processor - num = driver(outputFileName+toString(pid) + ".temp", files[pid], accnos+toString(pid) + ".temp"); - //send numSeqs to parent - MPI_Send(&num, 1, MPI_INT, 0, tag, MPI_COMM_WORLD); - } - } - - MPI_Barrier(MPI_COMM_WORLD); //make everyone wait - just in case -#else - //loop through and create all the processes you want while (process != processors) { int pid = fork(); @@ -562,13 +1639,14 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later process++; }else if (pid == 0){ - num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp"); + num = driver(outputFileName + toString(getpid()) + ".temp", files[process], accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", numChimeras); //pass numSeqs to parent ofstream out; string tempFile = outputFileName + toString(getpid()) + ".num.temp"; m->openOutputFile(tempFile, out); out << num << endl; + out << numChimeras << endl; out.close(); exit(0); @@ -580,7 +1658,7 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename } //do my part - num = driver(outputFileName, files[0], accnos); + num = driver(outputFileName, files[0], accnos, alns, numChimeras); //force parent to wait until all the processes are done for (int i=0;iopenInputFile(tempFile, in); - if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; } - in.close(); remove(tempFile.c_str()); + if (!in.eof()) { + int tempNum = 0; + in >> tempNum; m->gobble(in); + num += tempNum; + in >> tempNum; + numChimeras += tempNum; + } + in.close(); m->mothurRemove(tempFile); + } +#else + ////////////////////////////////////////////////////////////////////////////////////////////////////// + //Windows version shared memory, so be careful when passing variables through the preClusterData struct. + //Above fork() will clone, so memory is separate, but that's not the case with windows, + ////////////////////////////////////////////////////////////////////////////////////////////////////// + + //divide file + int count = 0; + int spot = 0; + map filehandles; + map::iterator it3; + + ofstream* temp; + for (int i = 0; i < processors; i++) { + temp = new ofstream; + filehandles[i] = temp; + m->openOutputFile(filename+toString(i)+".temp", *(temp)); + files.push_back(filename+toString(i)+".temp"); } + ifstream in; + m->openInputFile(filename, in); + + while(!in.eof()) { + + if (m->control_pressed) { in.close(); for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) { (*(it3->second)).close(); delete it3->second; } return 0; } + + Sequence tempSeq(in); m->gobble(in); + + if (tempSeq.getName() != "") { + tempSeq.printSequence(*(filehandles[spot])); + spot++; count++; + if (spot == processors) { spot = 0; } + } + } + in.close(); + + //delete memory + for (it3 = filehandles.begin(); it3 != filehandles.end(); it3++) { + (*(it3->second)).close(); + delete it3->second; + } + + //sanity check for number of processors + if (count < processors) { processors = count; } + + vector pDataArray; + DWORD dwThreadIdArray[processors-1]; + HANDLE hThreadArray[processors-1]; + vector dummy; //used so that we can use the same struct for MyUchimeSeqsThreadFunction and MyUchimeThreadFunction + + //Create processor worker threads. + for( int i=1; isetBooleans(dups, useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount); + tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract, strand); + + pDataArray.push_back(tempUchime); + processIDS.push_back(i); + + //MySeqSumThreadFunction is in header. It must be global or static to work with the threads. + //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier + hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeSeqsThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]); + } + + + //using the main process as a worker saves time and memory + num = driver(outputFileName, files[0], accnos, alns, numChimeras); + + //Wait until all threads have terminated. + WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE); + + //Close all thread handles and free memory allocations. + for(int i=0; i < pDataArray.size(); i++){ + num += pDataArray[i]->count; + numChimeras += pDataArray[i]->numChimeras; + CloseHandle(hThreadArray[i]); + delete pDataArray[i]; + } +#endif //append output files - for(int i=0;iappendFiles((outputFileName + toString(processIDS[i]) + ".temp"), outputFileName); - remove((outputFileName + toString(processIDS[i]) + ".temp").c_str()); + m->mothurRemove((outputFileName + toString(processIDS[i]) + ".temp")); m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos); - remove((accnos + toString(processIDS[i]) + ".temp").c_str()); + m->mothurRemove((accnos + toString(processIDS[i]) + ".temp")); + + if (chimealns) { + m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns); + m->mothurRemove((alns + toString(processIDS[i]) + ".temp")); + } } -#endif - //get rid of the file pieces. - for (int i = 0; i < files.size(); i++) { remove(files[i].c_str()); } + //get rid of the file pieces. + for (int i = 0; i < files.size(); i++) { m->mothurRemove(files[i]); } return num; } catch(exception& e) { @@ -616,6 +1786,175 @@ int ChimeraUchimeCommand::createProcesses(string outputFileName, string filename exit(1); } } +/**************************************************************************************************/ + +int ChimeraUchimeCommand::createProcessesGroups(string outputFName, string filename, string accnos, string alns, string newCountFile, vector groups, string nameFile, string groupFile, string fastaFile) { + try { + + processIDS.clear(); + int process = 1; + int num = 0; + + CountTable newCount; + if (hasCount && dups) { newCount.readTable(nameFile, true, false); } + + //sanity check + if (groups.size() < processors) { processors = groups.size(); } + + //divide the groups between the processors + vector lines; + int numGroupsPerProcessor = groups.size() / processors; + for (int i = 0; i < processors; i++) { + int startIndex = i * numGroupsPerProcessor; + int endIndex = (i+1) * numGroupsPerProcessor; + if(i == (processors - 1)){ endIndex = groups.size(); } + lines.push_back(linePair(startIndex, endIndex)); + } + +#if defined (__APPLE__) || (__MACH__) || (linux) || (__linux) || (__linux__) || (__unix__) || (__unix) + + //loop through and create all the processes you want + while (process != processors) { + int pid = fork(); + + if (pid > 0) { + processIDS.push_back(pid); //create map from line number to pid so you can append files in correct order later + process++; + }else if (pid == 0){ + num = driverGroups(outputFName + toString(getpid()) + ".temp", filename + toString(getpid()) + ".temp", accnos + toString(getpid()) + ".temp", alns + toString(getpid()) + ".temp", accnos + ".byCount." + toString(getpid()) + ".temp", lines[process].start, lines[process].end, groups); + + //pass numSeqs to parent + ofstream out; + string tempFile = outputFName + toString(getpid()) + ".num.temp"; + m->openOutputFile(tempFile, out); + out << num << endl; + out.close(); + + exit(0); + }else { + m->mothurOut("[ERROR]: unable to spawn the necessary processes."); m->mothurOutEndLine(); + for (int i = 0; i < processIDS.size(); i++) { kill (processIDS[i], SIGINT); } + exit(0); + } + } + + //do my part + num = driverGroups(outputFName, filename, accnos, alns, accnos + ".byCount", lines[0].start, lines[0].end, groups); + + //force parent to wait until all the processes are done + for (int i=0;iopenInputFile(tempFile, in); + if (!in.eof()) { int tempNum = 0; in >> tempNum; num += tempNum; } + in.close(); m->mothurRemove(tempFile); + } + +#else + ////////////////////////////////////////////////////////////////////////////////////////////////////// + //Windows version shared memory, so be careful when passing variables through the uchimeData struct. + //Above fork() will clone, so memory is separate, but that's not the case with windows, + ////////////////////////////////////////////////////////////////////////////////////////////////////// + + vector pDataArray; + DWORD dwThreadIdArray[processors-1]; + HANDLE hThreadArray[processors-1]; + + //Create processor worker threads. + for( int i=1; isetBooleans(dups, useAbskew, chimealns, useMinH, useMindiv, useXn, useDn, useXa, useChunks, useMinchunk, useIdsmoothwindow, useMinsmoothid, useMaxp, skipgaps, skipgaps2, useMinlen, useMaxlen, ucl, useQueryfract, hasCount); + tempUchime->setVariables(abskew, minh, mindiv, xn, dn, xa, chunks, minchunk, idsmoothwindow, minsmoothid, maxp, minlen, maxlen, queryfract, strand); + + pDataArray.push_back(tempUchime); + processIDS.push_back(i); + + //MyUchimeThreadFunction is in header. It must be global or static to work with the threads. + //default security attributes, thread function name, argument to thread function, use default creation flags, returns the thread identifier + hThreadArray[i-1] = CreateThread(NULL, 0, MyUchimeThreadFunction, pDataArray[i-1], 0, &dwThreadIdArray[i-1]); + } + + + //using the main process as a worker saves time and memory + num = driverGroups(outputFName, filename, accnos, alns, accnos + ".byCount", lines[0].start, lines[0].end, groups); + + //Wait until all threads have terminated. + WaitForMultipleObjects(processors-1, hThreadArray, TRUE, INFINITE); + + //Close all thread handles and free memory allocations. + for(int i=0; i < pDataArray.size(); i++){ + num += pDataArray[i]->count; + CloseHandle(hThreadArray[i]); + delete pDataArray[i]; + } + + +#endif + + //read my own + if (hasCount && dups) { + if (!m->isBlank(accnos + ".byCount")) { + ifstream in2; + m->openInputFile(accnos + ".byCount", in2); + + string name, group; + while (!in2.eof()) { + in2 >> name >> group; m->gobble(in2); + newCount.setAbund(name, group, 0); + } + in2.close(); + } + m->mothurRemove(accnos + ".byCount"); + } + + //append output files + for(int i=0;iappendFiles((outputFName + toString(processIDS[i]) + ".temp"), outputFName); + m->mothurRemove((outputFName + toString(processIDS[i]) + ".temp")); + + m->appendFiles((accnos + toString(processIDS[i]) + ".temp"), accnos); + m->mothurRemove((accnos + toString(processIDS[i]) + ".temp")); + + if (chimealns) { + m->appendFiles((alns + toString(processIDS[i]) + ".temp"), alns); + m->mothurRemove((alns + toString(processIDS[i]) + ".temp")); + } + + if (hasCount && dups) { + if (!m->isBlank(accnos + ".byCount." + toString(processIDS[i]) + ".temp")) { + ifstream in2; + m->openInputFile(accnos + ".byCount." + toString(processIDS[i]) + ".temp", in2); + + string name, group; + while (!in2.eof()) { + in2 >> name >> group; m->gobble(in2); + newCount.setAbund(name, group, 0); + } + in2.close(); + } + m->mothurRemove(accnos + ".byCount." + toString(processIDS[i]) + ".temp"); + } + } + + //print new *.pick.count_table + if (hasCount && dups) { newCount.printTable(newCountFile); } + + return num; + + } + catch(exception& e) { + m->errorOut(e, "ChimeraUchimeCommand", "createProcessesGroups"); + exit(1); + } +} /**************************************************************************************************/