X-Git-Url: https://git.donarmstrong.com/?a=blobdiff_plain;f=bp_scripts%2FQA_Illumina_report.rb;h=d50238509b04e6e47900762cb9fa3d387a91cc8d;hb=d72b568061e47185b9d68eabe2b09a0d55fbed20;hp=d82c0cf4b1793c1091dc46844ca129639ef3e2ee;hpb=846f7af09551a46b046d25ed01429f7c88ef6982;p=biopieces.git diff --git a/bp_scripts/QA_Illumina_report.rb b/bp_scripts/QA_Illumina_report.rb index d82c0cf..d502385 100755 --- a/bp_scripts/QA_Illumina_report.rb +++ b/bp_scripts/QA_Illumina_report.rb @@ -29,7 +29,7 @@ def parse_analysis(file) File.open(file, 'r') do |ios| ios.each do |line| key, val = line.chomp.split(' ') - data[key] = val.to_i; + data[key] = val.reverse.gsub(/(\d{3})(?=\d)/, '\\1,').reverse end end @@ -54,13 +54,14 @@ end tmpdir = Dir.mktmpdir seq_file = ARGV.shift -analyze_vals_file = File.join(tmpdir, 'analyze_vals.txt') -analyze_vals_trim_file = File.join(tmpdir, 'analyze_vals_trim.txt') -lendist_file = File.join(tmpdir, 'lendist.png') -scores_file = File.join(tmpdir, 'scores.png') -nucdist_file = File.join(tmpdir, 'nucdist.png') -lendist_bin_file = File.join(tmpdir, 'lendist_bin.png') -scores_bin_file = File.join(tmpdir, 'scores_bin.png') +analyze_vals_file = File.join(tmpdir, 'analyze_vals.txt') +analyze_vals_trim_file = File.join(tmpdir, 'analyze_vals_trim_noadapt.txt') +analyze_vals_trim_noadapt_file = File.join(tmpdir, 'analyze_vals_trim.txt') +lendist_file = File.join(tmpdir, 'lendist.png') +scores_file = File.join(tmpdir, 'scores.png') +nucdist_file = File.join(tmpdir, 'nucdist.png') +lendist_bin_file = File.join(tmpdir, 'lendist_bin.png') +scores_bin_file = File.join(tmpdir, 'scores_bin.png') STDERR.puts "Analyzing sequences ... " @@ -71,9 +72,13 @@ system( trim_seq -l 3 -m 25 | grab -e 'SEQ_LEN > 0' | analyze_vals -k SEQ -o #{analyze_vals_trim_file} | + find_adaptor -l 6 -L 6 -f ACACGACGCTCTTCCGATCT -r AGATCGGAAGAGCACACGTC | + clip_adaptor | + grab -e 'SEQ_LEN > 0' | + analyze_vals -k SEQ -o #{analyze_vals_trim_noadapt_file} | plot_distribution -k SEQ_LEN -T 'Sequence length distribution' -X 'Sequence length' -t png -o #{lendist_file} | plot_scores -c -t png -o #{scores_file} | - plot_nucleotide_distribution -t png -o #{nucdist_file} | + plot_nucleotide_distribution -c -t png -o #{nucdist_file} | bin_vals -k SEQ_LEN -b 25 | plot_distribution -T '25 bases bin sequence length distribution' -X 'Sequence length' -k SEQ_LEN_BIN -t png -o #{lendist_bin_file} | mean_scores | @@ -85,6 +90,7 @@ STDERR.puts "done.\n" analysis1 = parse_analysis(analyze_vals_file) analysis2 = parse_analysis(analyze_vals_trim_file) +analysis3 = parse_analysis(analyze_vals_trim_noadapt_file) template = %{ @@ -97,16 +103,16 @@ template = %{
File: <%= seq_file %>
Before trimming | After trimming | ||
Number of sequences | <%= analysis1['COUNT'] %> | <%= analysis2['COUNT'] %> | |
Number of bases | <%= analysis1['SUM'] %> | <%= analysis2['SUM'] %> | |
Min sequence length | <%= analysis1['MIN'] %> | <%= analysis2['MIN'] %> | |
Max sequence length | <%= analysis1['MAX'] %> | <%= analysis2['MAX'] %> | |
Mean sequence length | <%= analysis1['MEAN'] %> | <%= analysis2['MEAN'] %> | |
Before trimming | After trimming | After adaptor removal | |
Number of sequences | <%= analysis1['COUNT'] %> | <%= analysis2['COUNT'] %> | <%= analysis3['COUNT'] %> |
Number of bases | <%= analysis1['SUM'] %> | <%= analysis2['SUM'] %> | <%= analysis3['SUM'] %> |
Min sequence length | <%= analysis1['MIN'] %> | <%= analysis2['MIN'] %> | <%= analysis3['MIN'] %> |
Max sequence length | <%= analysis1['MAX'] %> | <%= analysis2['MAX'] %> | <%= analysis3['MAX'] %> |
Mean sequence length | <%= analysis1['MEAN'] %> | <%= analysis2['MEAN'] %> | <%= analysis3['MEAN'] %> |
Sequence trimming was performed by removing from the ends all residues until 3 consecutive
residues with quality score larger than or equal to 25.
-All plots are after sequence trimming.
+All plots are after sequence trimming and adaptor removal.