@entry = Seq.new
end
- # def test_Seq# autoremoves whitespace, newlines, and carriage returns
+ # # autoremoves whitespace, newlines, and carriage returns
+ # def test_Seq_strip
# dna = Seq.new
# dna.seq = "A\tT\r\tC\nG "
# assert_equal(dna.seq, "ATCG")
end
end
+ def test_Seq_shuffle_returns_correctly
+ orig = "actgactgactgatcgatcgatcgatcgtactg"
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ entry_shuf = @entry.shuffle
+ assert_equal(orig, @entry.seq)
+ assert_not_equal(@entry.seq, entry_shuf.seq)
+ end
+
+ def test_Seq_shuffle_bang_returns_correctly
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ assert_not_equal(@entry.seq, @entry.shuffle!.seq)
+ end
+
def test_Seq_subseq_with_start_lt_0_raises
@entry.seq = "ATCG"
assert_raise(SeqError) { @entry.subseq(-1, 1) }
assert_equal("-atCG", @entry.mask_seq_soft!(20).seq)
end
+ # qual score detection
+
+ def test_Seq_qual_base33_returns_correctly
+ # self.qual.match(/[!-:]/)
+ @entry.qual = '!"#$%&\'()*+,-./0123456789:'
+ assert_equal(true, @entry.qual_base33? )
+ @entry.qual = 32.chr
+ assert_equal(false, @entry.qual_base33? )
+ @entry.qual = 59.chr
+ assert_equal(false, @entry.qual_base33? )
+ end
+
+ def test_Seq_qual_base64_returns_correctly
+ # self.qual.match(/[K-h]/)
+ @entry.qual = 'KLMNOPQRSTUVWXYZ[\]^_`abcdefgh'
+ assert_equal(true, @entry.qual_base64? )
+ @entry.qual = 74.chr
+ assert_equal(false, @entry.qual_base64? )
+ @entry.qual = 105.chr
+ assert_equal(false, @entry.qual_base64? )
+ end
+
+ def test_Seq_qual_valid_with_nil_qual_raises
+ assert_raise(SeqError) { @entry.qual_valid?("illumina1.8") }
+ end
+
+ def test_Seq_qual_valid_with_bad_encoding_raises
+ @entry.qual = "abc"
+ assert_raise(SeqError) { @entry.qual_valid?("foobar") }
+ end
+
+ def test_Seq_qual_valid_returns_correctly
+ tests = [["sanger", 0, 93, 33],
+ ["454", 0, 62, 64],
+ ["solexa", -5, 62, 64],
+ ["illumina13", 0, 62, 64],
+ ["illumina15", 0, 62, 64],
+ ["illumina18", 0, 93, 33]]
+
+ tests.each do |test|
+ @entry.qual = (test[1] + test[-1]).chr + (test[2] + test[-1]).chr
+ assert_equal(true, @entry.qual_valid?(test[0]))
+ @entry.qual = (test[1] + test[-1] - 1).chr
+ assert_equal(false, @entry.qual_valid?(test[0]))
+ @entry.qual = (test[2] + test[-1] + 1).chr
+ assert_equal(false, @entry.qual_valid?(test[0]))
+ end
+ end
+
# convert sanger to ...
def test_Seq_convert_scores_bang_from_sanger_to_sanger_returns_OK
@entry.qual = 'BCDEFGHI'
assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'illumina18').qual)
end
+
+ def test_Seq_scores_mean_without_qual_raises
+ @entry.qual = nil
+ assert_raise(SeqError) { @entry.scores_mean }
+ end
+
+ def test_Seq_scores_mean_returns_correctly
+ @entry.qual = '@@hh'
+ assert_equal(20.0, @entry.scores_mean)
+ end
end
__END__