@entry = Seq.new
end
- # def test_Seq# autoremoves whitespace, newlines, and carriage returns
+ # # autoremoves whitespace, newlines, and carriage returns
+ # def test_Seq_strip
# dna = Seq.new
# dna.seq = "A\tT\r\tC\nG "
# assert_equal(dna.seq, "ATCG")
end
end
+ def test_Seq_shuffle_returns_correctly
+ orig = "actgactgactgatcgatcgatcgatcgtactg"
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ entry_shuf = @entry.shuffle
+ assert_equal(orig, @entry.seq)
+ assert_not_equal(@entry.seq, entry_shuf.seq)
+ end
+
+ def test_Seq_shuffle_bang_returns_correctly
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ assert_not_equal(@entry.seq, @entry.shuffle!.seq)
+ end
+
def test_Seq_subseq_with_start_lt_0_raises
@entry.seq = "ATCG"
assert_raise(SeqError) { @entry.subseq(-1, 1) }
end
def test_Seq_qual_valid_returns_correctly
- tests = [["sanger", 0, 40, 33],
- ["454", 0, 40, 64],
- ["solexa", -5, 40, 64],
- ["illumina13", 0, 40, 64],
- ["illumina15", 0, 40, 64],
- ["illumina18", 0, 41, 33]]
+ tests = [["sanger", 0, 93, 33],
+ ["454", 0, 62, 64],
+ ["solexa", -5, 62, 64],
+ ["illumina13", 0, 62, 64],
+ ["illumina15", 0, 62, 64],
+ ["illumina18", 0, 93, 33]]
tests.each do |test|
@entry.qual = (test[1] + test[-1]).chr + (test[2] + test[-1]).chr