@entry = Seq.new
end
- # def test_Seq# autoremoves whitespace, newlines, and carriage returns
+ # # autoremoves whitespace, newlines, and carriage returns
+ # def test_Seq_strip
# dna = Seq.new
# dna.seq = "A\tT\r\tC\nG "
# assert_equal(dna.seq, "ATCG")
assert_raise(SeqError) { @entry.to_bp }
end
+ def test_Seq_to_fasta_raises_on_missing_seq_name
+ @entry.seq = 'ATCG'
+ assert_raise(SeqError) { @entry.to_fasta }
+ end
+
+ def test_Seq_to_fasta_raises_on_empty_seq_name
+ @entry.seq_name = ''
+ @entry.seq = 'ATCG'
+ assert_raise(SeqError) { @entry.to_fasta }
+ end
+
+ def test_Seq_to_fasta_raises_on_missing_seq
+ @entry.seq_name = 'test'
+ assert_raise(SeqError) { @entry.to_fasta }
+ end
+
+ def test_Seq_to_fasta_raises_on_empty_seq
+ @entry.seq_name = 'test'
+ @entry.seq = ''
+ assert_raise(SeqError) { @entry.to_fasta }
+ end
+
def test_Seq_to_fasta_returns_correct_entry
@entry.seq_name = 'test'
@entry.seq = 'ATCG'
def test_Seq_reverse_returns_correctly
@entry.seq = "ATCG"
- assert_equal("GCTA", @entry.reverse.seq)
+ new_entry = @entry.reverse
+ assert_equal("GCTA", new_entry.seq)
+ assert_equal("ATCG", @entry.seq)
+ end
+
+ def test_Seq_reverse_bang_returns_correctly
+ @entry.seq = "ATCG"
+ @entry.reverse!
+ assert_equal("GCTA", @entry.seq)
end
def test_Seq_complement_raises_if_no_sequence
def test_Seq_complement_for_DNA_is_correct
@entry.seq = 'ATCGatcg'
@entry.type = 'dna'
- assert_equal("TAGCtagc", @entry.complement)
+ comp = @entry.complement
+ assert_equal("TAGCtagc", comp.seq)
+ assert_equal("ATCGatcg", @entry.seq)
end
def test_Seq_complement_for_RNA_is_correct
@entry.seq = 'AUCGaucg'
@entry.type = 'rna'
- assert_equal("UAGCuagc", @entry.complement)
+ comp = @entry.complement
+ assert_equal("UAGCuagc", comp.seq)
+ assert_equal("AUCGaucg", @entry.seq)
+ end
+
+ def test_Seq_complement_bang_raises_if_no_sequence
+ @entry.type = 'dna'
+ assert_raise(SeqError) { @entry.complement! }
+ end
+
+ def test_Seq_complement_bang_raises_on_bad_type
+ @entry.seq = 'ATCG'
+ @entry.type = 'protein'
+ assert_raise(SeqError) { @entry.complement! }
end
- def test_Seq_reverse_complement_for_DNA_is_correct
+ def test_Seq_complement_bang_for_DNA_is_correct
@entry.seq = 'ATCGatcg'
@entry.type = 'dna'
- assert_equal("cgatCGAT", @entry.reverse_complement.seq)
+ assert_equal("TAGCtagc", @entry.complement!.seq)
end
- def test_Seq_reverse_complement_for_RNA_is_correct
+ def test_Seq_complement_bang_for_RNA_is_correct
@entry.seq = 'AUCGaucg'
@entry.type = 'rna'
- assert_equal("cgauCGAU", @entry.reverse_complement.seq)
+ assert_equal("UAGCuagc", @entry.complement!.seq)
end
+
def test_Seq_hamming_distance_returns_correctly
seq1 = Seq.new("test1", "ATCG")
seq2 = Seq.new("test2", "atgg")
end
end
- def test_Seq_subseq_with_start_lt_0_raises
- @entry.seq = "ATCG"
- assert_raise(SeqError) { @entry.subseq(-1, 1) }
+ def test_Seq_shuffle_returns_correctly
+ orig = "actgactgactgatcgatcgatcgatcgtactg"
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ entry_shuf = @entry.shuffle
+ assert_equal(orig, @entry.seq)
+ assert_not_equal(@entry.seq, entry_shuf.seq)
end
- def test_Seq_subseq_with_length_lt_1_raises
+ def test_Seq_shuffle_bang_returns_correctly
+ @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
+ assert_not_equal(@entry.seq, @entry.shuffle!.seq)
+ end
+
+ def test_Seq_subseq_with_start_lt_0_raises
@entry.seq = "ATCG"
- assert_raise(SeqError) { @entry.subseq(0, 0) }
+ assert_raise(SeqError) { @entry.subseq(-1, 1) }
end
def test_Seq_subseq_with_start_plus_length_gt_seq_raises
assert_raise(SeqError) { @entry.subseq!(-1, 1) }
end
- def test_Seq_subseq_bang_with_length_lt_1_raises
- @entry.seq = "ATCG"
- assert_raise(SeqError) { @entry.subseq!(0, 0) }
- end
-
def test_Seq_subseq_bang_with_start_plus_length_gt_seq_raises
@entry.seq = "ATCG"
assert_raise(SeqError) { @entry.subseq!(0, 5) }
assert_equal("ATCG", @entry.subseq_rand(4).seq)
end
+ def test_Seq_indels_remove_without_qual_returns_correctly
+ @entry.seq = "A-T.CG~CG"
+ @entry.qual = nil
+ assert_equal("ATCGCG", @entry.indels_remove.seq)
+ end
+
+ def test_Seq_indels_remove_with_qual_returns_correctly
+ @entry.seq = "A-T.CG~CG"
+ @entry.qual = "a@b@cd@fg"
+ assert_equal("ATCGCG", @entry.indels_remove.seq)
+ assert_equal("abcdfg", @entry.indels_remove.qual)
+ end
+
def test_Seq_composition_returns_correctly
@entry.seq = "AAAATTTCCG"
assert_equal(4, @entry.composition["A"])
@entry.seq = "--AAAa"
assert_equal(25.00, @entry.soft_mask)
end
-end
+ def test_Seq_mask_seq_hard_bang_with_nil_seq_raises
+ @entry.seq = nil
+ @entry.qual = ""
+
+ assert_raise(SeqError) { @entry.mask_seq_hard!(20) }
+ end
+
+ def test_Seq_mask_seq_hard_bang_with_nil_qual_raises
+ @entry.seq = ""
+ @entry.qual = nil
+
+ assert_raise(SeqError) { @entry.mask_seq_hard!(20) }
+ end
+
+ def test_Seq_mask_seq_hard_bang_with_bad_cutoff_raises
+ assert_raise(SeqError) { @entry.mask_seq_hard!(-1) }
+ assert_raise(SeqError) { @entry.mask_seq_hard!(41) }
+ end
+
+ def test_Seq_mask_seq_hard_bang_with_OK_cutoff_dont_raise
+ @entry.seq = "ATCG"
+ @entry.qual = "RSTU"
+
+ assert_nothing_raised { @entry.mask_seq_hard!(0) }
+ assert_nothing_raised { @entry.mask_seq_hard!(40) }
+ end
+
+ def test_Seq_mask_seq_hard_bang_returns_correctly
+ @entry.seq = "-ATCG"
+ @entry.qual = "RRSTU"
+
+ assert_equal("-NNCG", @entry.mask_seq_hard!(20).seq)
+ end
+
+ def test_Seq_mask_seq_soft_bang_with_nil_seq_raises
+ @entry.seq = nil
+ @entry.qual = ""
+
+ assert_raise(SeqError) { @entry.mask_seq_soft!(20) }
+ end
+
+ def test_Seq_mask_seq_soft_bang_with_nil_qual_raises
+ @entry.seq = ""
+ @entry.qual = nil
+
+ assert_raise(SeqError) { @entry.mask_seq_soft!(20) }
+ end
+
+ def test_Seq_mask_seq_soft_bang_with_bad_cutoff_raises
+ assert_raise(SeqError) { @entry.mask_seq_soft!(-1) }
+ assert_raise(SeqError) { @entry.mask_seq_soft!(41) }
+ end
+
+ def test_Seq_mask_seq_soft_bang_with_OK_cutoff_dont_raise
+ @entry.seq = "ATCG"
+ @entry.qual = "RSTU"
+
+ assert_nothing_raised { @entry.mask_seq_soft!(0) }
+ assert_nothing_raised { @entry.mask_seq_soft!(40) }
+ end
+
+ def test_Seq_mask_seq_soft_bang_returns_correctly
+ @entry.seq = "-ATCG"
+ @entry.qual = "RRSTU"
+
+ assert_equal("-atCG", @entry.mask_seq_soft!(20).seq)
+ end
+
+ # qual score detection
+
+ def test_Seq_qual_base33_returns_correctly
+ # self.qual.match(/[!-:]/)
+ @entry.qual = '!"#$%&\'()*+,-./0123456789:'
+ assert_equal(true, @entry.qual_base33? )
+ @entry.qual = 32.chr
+ assert_equal(false, @entry.qual_base33? )
+ @entry.qual = 59.chr
+ assert_equal(false, @entry.qual_base33? )
+ end
+
+ def test_Seq_qual_base64_returns_correctly
+ # self.qual.match(/[K-h]/)
+ @entry.qual = 'KLMNOPQRSTUVWXYZ[\]^_`abcdefgh'
+ assert_equal(true, @entry.qual_base64? )
+ @entry.qual = 74.chr
+ assert_equal(false, @entry.qual_base64? )
+ @entry.qual = 105.chr
+ assert_equal(false, @entry.qual_base64? )
+ end
+
+ def test_Seq_qual_valid_with_nil_qual_raises
+ assert_raise(SeqError) { @entry.qual_valid?("illumina1.8") }
+ end
+
+ def test_Seq_qual_valid_with_bad_encoding_raises
+ @entry.qual = "abc"
+ assert_raise(SeqError) { @entry.qual_valid?("foobar") }
+ end
+
+ def test_Seq_qual_valid_returns_correctly
+ tests = [["sanger", 0, 93, 33],
+ ["454", 0, 62, 64],
+ ["solexa", -5, 62, 64],
+ ["illumina13", 0, 62, 64],
+ ["illumina15", 0, 62, 64],
+ ["illumina18", 0, 93, 33]]
+
+ tests.each do |test|
+ @entry.qual = (test[1] + test[-1]).chr + (test[2] + test[-1]).chr
+ assert_equal(true, @entry.qual_valid?(test[0]))
+ @entry.qual = (test[1] + test[-1] - 1).chr
+ assert_equal(false, @entry.qual_valid?(test[0]))
+ @entry.qual = (test[2] + test[-1] + 1).chr
+ assert_equal(false, @entry.qual_valid?(test[0]))
+ end
+ end
+
+ # convert sanger to ...
+
+ def test_Seq_convert_scores_bang_from_sanger_to_sanger_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('sanger', 'sanger').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_sanger_to_solexa_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'solexa').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_sanger_to_illumina13_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'illumina13').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_sanger_to_illumina15_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('sanger', 'illumina15').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_sanger_to_illumina18_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('sanger', 'illumina18').qual)
+ end
+
+ # convert solexa to ...
+
+ def test_Seq_convert_scores_bang_from_solexa_to_sanger_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('solexa', 'sanger').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_solexa_to_solexa_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'solexa').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_solexa_to_illumina13_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'illumina13').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_solexa_to_illumina15_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('solexa', 'illumina15').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_solexa_to_illumina18_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('solexa', 'illumina18').qual)
+ end
+
+ # convert illumina13 to ...
+
+ def test_Seq_convert_scores_bang_from_illumina13_to_sanger_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina13', 'sanger').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina13_to_solexa_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'solexa').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina13_to_illumina13_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'illumina13').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina13_to_illumina15_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina13', 'illumina15').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina13_to_illumina18_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina13', 'illumina18').qual)
+ end
+
+ # convert illumina15 to ...
+
+ def test_Seq_convert_scores_bang_from_illumina15_to_sanger_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina15', 'sanger').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina15_to_solexa_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'solexa').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina15_to_illumina13_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'illumina13').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina15_to_illumina15_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina15', 'illumina15').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina15_to_illumina18_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal(%q[#$%&'()*], @entry.convert_scores!('illumina15', 'illumina18').qual)
+ end
+
+ # convert illumina18 to ...
+
+ def test_Seq_convert_scores_bang_from_illumina18_to_sanger_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'sanger').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina18_to_solexa_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'solexa').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina18_to_illumina13_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'illumina13').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina18_to_illumina15_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('abcdefgh', @entry.convert_scores!('illumina18', 'illumina15').qual)
+ end
+
+ def test_Seq_convert_scores_bang_from_illumina18_to_illumina18_returns_OK
+ @entry.qual = 'BCDEFGHI'
+ assert_equal('BCDEFGHI', @entry.convert_scores!('illumina18', 'illumina18').qual)
+ end
+
+ def test_Seq_scores_mean_without_qual_raises
+ @entry.qual = nil
+ assert_raise(SeqError) { @entry.scores_mean }
+ end
+
+ def test_Seq_scores_mean_returns_correctly
+ @entry.qual = '@@hh'
+ assert_equal(20.0, @entry.scores_mean)
+ end
+end
__END__