4 \title{Read DNA Sequences in a File}
6 These functions read DNA sequences in a file, and returns a matrix or a
7 list of DNA sequences with the names of the taxa read in the file as
8 rownames or names, respectively. By default, the sequences are stored
9 in binary format, otherwise (if \code{as.character = "TRUE"}) in lower
13 read.dna(file, format = "interleaved", skip = 0,
14 nlines = 0, comment.char = "#",
15 as.character = FALSE, as.matrix = NULL)
19 \item{file}{a file name specified by either a variable of mode character,
20 or a double-quoted string.}
21 \item{format}{a character string specifying the format of the DNA
22 sequences. Four choices are possible: \code{"interleaved"},
23 \code{"sequential"}, \code{"clustal"}, or \code{"fasta"}, or any
24 unambiguous abbreviation of these.}
25 \item{skip}{the number of lines of the input file to skip before
26 beginning to read data (ignored for FASTA files; see below).}
27 \item{nlines}{the number of lines to be read (by default the file is
28 read untill its end; ignored for FASTA files)).}
29 \item{comment.char}{a single character, the remaining of the line
30 after this character is ignored (ignored for FASTA files).}
31 \item{as.character}{a logical controlling whether to return the
32 sequences as an object of class \code{"DNAbin"} (the default).}
33 \item{as.matrix}{(used if \code{format = "fasta"}) one of the three
34 followings: (i) \code{NULL}: returns the sequences in a matrix if
35 they are of the same length, otherwise in a list; (ii) \code{TRUE}:
36 returns the sequences in a matrix, or stops with an error if they
37 are of different lengths; (iii) \code{FALSE}: always returns the
41 \code{read.dna} follows the interleaved and sequential formats defined
42 in PHYLIP (Felsenstein, 1993) but with the original feature than there
43 is no restriction on the lengths of the taxa names. For these two
44 formats, the first line of the file must contain the dimensions of the
45 data (the numbers of taxa and the numbers of nucleotides); the
46 sequences are considered as aligned and thus must be of the same
47 lengths for all taxa. For the FASTA format, the conventions defined in
48 the URL below (see References) are followed; the sequences are taken as
49 non-aligned. For all formats, the nucleotides can be arranged in any
50 way with blanks and line-breaks inside (with the restriction that the
51 first ten nucleotides must be contiguous for the interleaved and
52 sequential formats, see below). The names of the sequences are read in
53 the file. Particularities for each format are detailed below.
56 \item{Interleaved:}{the function starts to read the sequences after it
57 finds one or more spaces (or tabulations). All characters before the
58 sequences are taken as the taxa names after removing the leading and
59 trailing spaces (so spaces in taxa names are allowed). It is assumed
60 that the taxa names are not repeated in the subsequent blocks of
63 \item{Sequential:}{the same criterion than for the interleaved format
64 is used to start reading the sequences and the taxa names; the
65 sequences are then read until the number of nucleotides specified in
66 the first line of the file is reached. This is repeated for each taxa.}
68 \item{Clustal:}{this is the format output by the Clustal programs
69 (.aln). It is somehow similar to the interleaved format: the
70 differences being that the dimensions of the data are not indicated
71 in the file, and the names of the sequences are repeated in each block.}
73 \item{FASTA:}{This looks like the sequential format but the taxa names
74 (or rather a description of the sequence) are on separate lines
75 beginning with a `greater than' character `>' (there may be
76 leading spaces before this character). These lines are taken as taxa
77 names after removing the `>' and the possible leading and trailing
78 spaces. All the data in the file before the first sequence is ignored.}
81 a matrix or a list (if \code{format = "fasta"}) of DNA sequences
82 stored in binary format, or of mode character (if \code{as.character =
85 \code{read.FASTA} always returns a list of class \code{"DNAbin"}.
88 Anonymous. FASTA format description.
89 \url{http://www.ncbi.nlm.nih.gov/BLAST/fasta.html}
91 Anonymous. IUPAC ambiguity codes.
92 \url{http://www.ncbi.nlm.nih.gov/SNP/iupac.html}
94 Felsenstein, J. (1993) Phylip (Phylogeny Inference Package) version
95 3.5c. Department of Genetics, University of Washington.
96 \url{http://evolution.genetics.washington.edu/phylip/phylip.html}
99 \code{\link{read.GenBank}}, \code{\link{write.dna}},
100 \code{\link{DNAbin}}, \code{\link{dist.dna}}, \code{\link{woodmouse}}
102 \author{Emmanuel Paradis}
104 ### a small extract from `data(woddmouse)'
106 "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
107 "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
108 "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
109 file = "exdna.txt", sep = "\n")
110 ex.dna <- read.dna("exdna.txt", format = "sequential")
113 ### the same data in interleaved format...
115 "No305 NTTCGAAAAA CACACCCACT",
116 "No304 ATTCGAAAAA CACACCCACT",
117 "No306 ATTCGAAAAA CACACCCACT",
118 " ACTAAAANTT ATCAGTCACT",
119 " ACTAAAAATT ATCAACCACT",
120 " ACTAAAAATT ATCAATCACT",
121 file = "exdna.txt", sep = "\n")
122 ex.dna2 <- read.dna("exdna.txt")
123 ### ... in clustal format...
124 cat("CLUSTAL (ape) multiple sequence alignment", "",
125 "No305 NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
126 "No304 ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
127 "No306 ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
128 " ************************** ****** ****",
129 file = "exdna.txt", sep = "\n")
130 ex.dna3 <- read.dna("exdna.txt", format = "clustal")
131 ### ... and in FASTA format
133 "NTTCGAAAAACACACCCACTACTAAAANTTATCAGTCACT",
135 "ATTCGAAAAACACACCCACTACTAAAAATTATCAACCACT",
137 "ATTCGAAAAACACACCCACTACTAAAAATTATCAATCACT",
138 file = "exdna.txt", sep = "\n")
139 ex.dna4 <- read.dna("exdna.txt", format = "fasta")
140 ### The first three are the same!
141 identical(ex.dna, ex.dna2)
142 identical(ex.dna, ex.dna3)
143 identical(ex.dna, ex.dna4)
144 unlink("exdna.txt") # clean-up