2 $:.unshift File.join(File.dirname(__FILE__), '..', '..', '..')
4 # Copyright (C) 2007-2013 Martin A. Hansen.
6 # This program is free software; you can redistribute it and/or
7 # modify it under the terms of the GNU General Public License
8 # as published by the Free Software Foundation; either version 2
9 # of the License, or (at your option) any later version.
11 # This program is distributed in the hope that it will be useful,
12 # but WITHOUT ANY WARRANTY; without even the implied warranty of
13 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
14 # GNU General Public License for more details.
16 # You should have received a copy of the GNU General Public License
17 # along with this program; if not, write to the Free Software
18 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
20 # http://www.gnu.org/copyleft/gpl.html
22 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
24 # This software is part of the Biopieces framework (www.biopieces.org).
26 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
32 class HomopolymerTest < Test::Unit::TestCase
35 # 01234567890123456789
36 @entry = Seq.new(seq: "tacgatgctagcatgcacgg")
37 @entry.extend(Homopolymer)
40 test "#each_homopolymer returns empty with empty sequence" do
42 assert_equal([], @entry.each_homopolymer)
45 test "#each_homopolymer returns empty when none found" do
46 @entry.seq = "AtTcCcGggGnnNnn"
47 assert_equal([], @entry.each_homopolymer(6))
50 test "#each_homopolymer returns correctly" do
51 @entry.seq = "AtTcCcGggGnnNnn"
52 assert_equal('CCC', @entry.each_homopolymer(3).first.pattern)
53 assert_equal(3, @entry.each_homopolymer(3).first.pos)
54 assert_equal(3, @entry.each_homopolymer(3).first.length)
57 test "#each_homopolymer in block context returns correctly" do
58 @entry.seq = "AtTcCcGggGnnNnn"
60 @entry.each_homopolymer(3) do |hp|
61 assert_equal('CCC', hp.pattern)
62 assert_equal(3, hp.pos)
63 assert_equal(3, hp.length)