1 package Maasha::Solexa;
4 # Copyright (C) 2007-2008 Martin A. Hansen.
6 # This program is free software; you can redistribute it and/or
7 # modify it under the terms of the GNU General Public License
8 # as published by the Free Software Foundation; either version 2
9 # of the License, or (at your option) any later version.
11 # This program is distributed in the hope that it will be useful,
12 # but WITHOUT ANY WARRANTY; without even the implied warranty of
13 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
14 # GNU General Public License for more details.
16 # You should have received a copy of the GNU General Public License
17 # along with this program; if not, write to the Free Software
18 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
20 # http://www.gnu.org/copyleft/gpl.html
23 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> DESCRIPTION <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
26 # Routines for manipulation Solid sequence files with di-base encoding.
29 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
32 use vars qw( @ISA @EXPORT_OK );
36 @ISA = qw( Exporter );
44 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>> SUBROUTINES <<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
47 sub solexa_get_entry_octal
49 # Martin A. Hansen, August 2008
51 # Get the next Solexa entry form a file and returns
52 # a triple of [ seq_name, seq, score ].
53 # We asume a Solexa entry consists of four lines:
55 # @HWI-EAS157_20FFGAAXX:2:1:888:434
56 # TTGGTCGCTCGCTCCGCGACCTCAGATCAGACGTGG
57 # +HWI-EAS157_20FFGAAXX:2:1:888:434
58 # hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhKhe
60 my ( $fh, # filehandle to Solexa file
65 my ( $seq_header, $seq, $score_head, $score, @scores );
69 $score_header = <$fh>;
72 return if not defined $score;
79 @scores = split //, $score;
81 map { $_ = int( score_oct2dec( $_ ) ) } @scores;
83 $seq_header =~ s/^@//;
85 $score = join( ";", @scores );
87 return wantarray ? ( $seq_header, $seq, $score ) : [ $seq_header, $seq, $score ];
93 # Martin A. Hansen, August 2008
95 # Converts a Solexa score in octal format to decimal format.
97 # http://maq.sourceforge.net/fastq.shtml
99 my ( $char, # octal score
104 return 10 * log(1 + 10 ** ((ord( $char ) - 64) / 10.0)) / log(10);
108 sub solexa_get_entry_decimal
110 # Martin A. Hansen, August 2008
112 # Get the next Solexa entry form a file and returns
113 # a triple of [ seq_name, seq, score ].
114 # We asume a Solexa entry consists of four lines:
116 # @USI-EAS18_131_4_1_352_619
117 # ATGGATGGGTTGGAGATGCCCTCTGTAGGCACCAT
118 # +USI-EAS18_131_4_1_352_619
119 # 40 40 40 40 40 40 40 40 40 40 40 25 25 40 40 34 40 40 40 40 32 39 40 36 34 19 40 19 30 16 21 11 21 18 11
121 my ( $fh, # filehandle to Solexa file
126 my ( $seq_header, $seq, $score_head, $score, @scores );
130 $score_header = <$fh>;
133 return if not defined $score;
140 @scores = split / /, $score;
142 $seq_header =~ s/^@//;
144 $score = join( ";", @scores );
146 return wantarray ? ( $seq_header, $seq, $score ) : [ $seq_header, $seq, $score ];
152 # Martin A. Hansen, September 2008.
154 # Converts a Solexa entry to a Biopiece record.
156 my ( $entry, # Solexa entry
157 $qualilty, # Quality cutoff
162 my ( @seqs, @scores, $i, %record );
164 @seqs = split //, $entry->[ SEQ ];
165 @scores = split /;/, $entry->[ SCORE ];
167 for ( $i = 0; $i < @scores; $i++ ) {
168 $seqs[ $i ] = lc $seqs[ $i ] if $scores[ $i ] < $quality;
171 $record{ "SEQ_NAME" } = $entry->[ SEQ_NAME ];
172 $record{ "SEQ" } = $entry->[ SEQ ];
173 $record{ "SCORES" } = $entry->[ SCORE ];
174 $record{ "SEQ_LEN" } = scalar @seqs;
175 $record{ "SCORE_MEAN" } = sprintf ( "%.2f", Maasha::Calc::mean( \@scores ) );
177 return wantarray ? %record : \%record;
181 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<