2 $:.unshift File.join(File.dirname(__FILE__), '..', '..')
4 # Copyright (C) 2011 Martin A. Hansen.
6 # This program is free software; you can redistribute it and/or
7 # modify it under the terms of the GNU General Public License
8 # as published by the Free Software Foundation; either version 2
9 # of the License, or (at your option) any later version.
11 # This program is distributed in the hope that it will be useful,
12 # but WITHOUT ANY WARRANTY; without even the implied warranty of
13 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
14 # GNU General Public License for more details.
16 # You should have received a copy of the GNU General Public License
17 # along with this program; if not, write to the Free Software
18 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
20 # http://www.gnu.org/copyleft/gpl.html
22 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
24 # This software is part of the Biopieces framework (www.biopieces.org).
26 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
32 class TestSeq < Test::Unit::TestCase
37 test "Seq.new_bp returns correctly" do
38 record = {:SEQ_NAME => "test", :SEQ => "ATCG", :SEQ_TYPE => :dna, :SCORES => "hhhh"}
39 seq = Seq.new_bp(record)
40 assert_equal("test", seq.seq_name)
41 assert_equal("ATCG", seq.seq)
42 assert_equal(:dna, seq.type)
43 assert_equal("hhhh", seq.qual)
46 test "#is_dna? with no sequence type returns false" do
47 assert(@entry.is_dna? == false)
50 test "#is_dna? with dna sequence type returns true" do
52 assert(@entry.is_dna? == true)
55 test "#is_rna? with no sequence type returns false" do
56 assert(@entry.is_rna? == false)
59 test "#is_rna? with rna sequence type returns true" do
61 assert(@entry.is_rna? == true)
64 test "#is_protein? with no sequence type returns false" do
65 assert(@entry.is_protein? == false)
68 test "#is_protein? with protein sequence type returns true" do
69 @entry.type = :protein
70 assert_equal(true, @entry.is_protein?)
73 test "#type_guess without sequence raises" do
74 assert_raise(SeqError) { @entry.type_guess }
77 test "#type_guess with protein returns protein" do
78 @entry.seq = 'atcatcrFgatcg'
79 assert_equal(:protein, @entry.type_guess)
82 test "#type_guess with rna returns rna" do
83 @entry.seq = 'atcatcrUgatcg'
84 assert_equal(:rna, @entry.type_guess)
87 test "#type_guess with dna returns dna" do
88 @entry.seq = 'atcatcgatcg'
89 assert_equal(:dna, @entry.type_guess)
92 test "#type_guess! without sequence raises" do
93 assert_raise(SeqError) { @entry.type_guess! }
96 test "#type_guess! with protein returns protein" do
97 @entry.seq = 'atcatcrFgatcg'
99 assert_equal(:protein, @entry.type)
102 test "#type_guess! with rna returns rna" do
103 @entry.seq = 'atcatcrUgatcg'
105 assert_equal(:rna, @entry.type)
108 test "#type_guess! with dna returns dna" do
109 @entry.seq = 'atcatcgatcg'
111 assert_equal(:dna, @entry.type)
114 test "#length returns corretly" do
116 assert_equal(4, @entry.length)
119 test "#indels returns correctly" do
120 @entry.seq = 'ATCG.-~_'
121 assert_equal(4, @entry.indels)
124 test "#to_rna with no sequence raises" do
126 assert_raise(SeqError) { @entry.to_rna }
129 test "#to_rna with bad type raises" do
132 assert_raise(SeqError) { @entry.to_rna }
135 test "#to_rna transcribes correctly" do
136 @entry.seq = 'ATCGatcg'
138 assert_equal("AUCGaucg", @entry.to_rna)
141 test "#to_rna changes entry type to rna" do
142 @entry.seq = 'ATCGatcg'
145 assert_equal(:rna, @entry.type)
148 test "#to_dna with no sequence raises" do
150 assert_raise(SeqError) { @entry.to_dna }
153 test "#to_dna with bad type raises" do
156 assert_raise(SeqError) { @entry.to_dna }
159 test "#to_dna transcribes correctly" do
160 @entry.seq = 'AUCGaucg'
162 assert_equal("ATCGatcg", @entry.to_dna)
165 test "#to_dna changes entry type to dna" do
166 @entry.seq = 'AUCGaucg'
169 assert_equal(:dna, @entry.type)
172 test "#to_bp returns correct record" do
173 @entry.seq_name = 'test'
175 assert_equal({:SEQ_NAME=>"test", :SEQ=>"ATCG", :SEQ_LEN=>4}, @entry.to_bp)
178 test "#to_bp with missing seq_name raises" do
180 assert_raise(SeqError) { @entry.to_bp }
183 test "#to_bp with missing sequence raises" do
184 @entry.seq_name = 'test'
185 assert_raise(SeqError) { @entry.to_bp }
188 test "#to_fasta with missing seq_name raises" do
190 assert_raise(SeqError) { @entry.to_fasta }
193 test "#to_fasta with empty seq_name raises" do
196 assert_raise(SeqError) { @entry.to_fasta }
199 test "#to_fasta with missing seq raises" do
200 @entry.seq_name = 'test'
201 assert_raise(SeqError) { @entry.to_fasta }
204 test "#to_fasta with empty seq raises" do
205 @entry.seq_name = 'test'
207 assert_raise(SeqError) { @entry.to_fasta }
210 test "#to_fasta returns correct entry" do
211 @entry.seq_name = 'test'
213 assert_equal(">test\nATCG\n", @entry.to_fasta)
216 test "#to_fasta wraps correctly" do
217 entry = Seq.new("test", "ATCG")
218 assert_equal(">test\nAT\nCG\n", entry.to_fasta(2))
221 test "#to_fastq returns correct entry" do
222 @entry.seq_name = 'test'
225 assert_equal("@test\nATCG\n+\nhhhh\n", @entry.to_fastq)
228 test "#to_key with bad residue raises" do
229 entry = Seq.new("test", "AUCG")
230 assert_raise(SeqError) { entry.to_key }
233 test "#to_key returns correctly" do
234 entry = Seq.new("test", "ATCG")
235 assert_equal(54, entry.to_key)
238 test "#reverse returns correctly" do
240 new_entry = @entry.reverse
241 assert_equal("GCTA", new_entry.seq)
242 assert_equal("ATCG", @entry.seq)
245 test "#reverse! returns correctly" do
248 assert_equal("GCTA", @entry.seq)
251 test "#complement with no sequence raises" do
253 assert_raise(SeqError) { @entry.complement }
256 test "#complement with bad type raises" do
258 @entry.type = :protein
259 assert_raise(SeqError) { @entry.complement }
262 test "#complement for DNA is correct" do
263 @entry.seq = 'ATCGatcg'
265 comp = @entry.complement
266 assert_equal("TAGCtagc", comp.seq)
267 assert_equal("ATCGatcg", @entry.seq)
270 test "#complement for RNA is correct" do
271 @entry.seq = 'AUCGaucg'
273 comp = @entry.complement
274 assert_equal("UAGCuagc", comp.seq)
275 assert_equal("AUCGaucg", @entry.seq)
278 test "#complement! with no sequence raises" do
280 assert_raise(SeqError) { @entry.complement! }
283 test "#complement! with bad type raises" do
285 @entry.type = :protein
286 assert_raise(SeqError) { @entry.complement! }
289 test "#complement! for DNA is correct" do
290 @entry.seq = 'ATCGatcg'
292 assert_equal("TAGCtagc", @entry.complement!.seq)
295 test "#complement! for RNA is correct" do
296 @entry.seq = 'AUCGaucg'
298 assert_equal("UAGCuagc", @entry.complement!.seq)
302 test "#hamming distance returns correctly" do
303 seq1 = Seq.new("test1", "ATCG")
304 seq2 = Seq.new("test2", "atgg")
305 assert_equal(1, seq1.hamming_distance(seq2))
308 test "#generate with length < 1 raises" do
309 assert_raise(SeqError) { @entry.generate(-10, :dna) }
310 assert_raise(SeqError) { @entry.generate(0, :dna) }
313 test "#generate with bad type raises" do
314 assert_raise(SeqError) { @entry.generate(10, "foo") }
317 test "#generate with ok type dont raise" do
318 %w[dna rna protein].each do |type|
319 assert_nothing_raised { @entry.generate(10, type.to_sym) }
323 test "#shuffle returns correctly" do
324 orig = "actgactgactgatcgatcgatcgatcgtactg"
325 @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
326 entry_shuf = @entry.shuffle
327 assert_equal(orig, @entry.seq)
328 assert_not_equal(@entry.seq, entry_shuf.seq)
331 test "#shuffle! returns correctly" do
332 @entry.seq = "actgactgactgatcgatcgatcgatcgtactg"
333 assert_not_equal(@entry.seq, @entry.shuffle!.seq)
336 test "#<< with different types raises" do
338 assert_raise(SeqError) { @entry << Seq.new("test", "atcg", :dna) }
341 test "#<< with missing qual in one entry raises" do
344 assert_raise(SeqError) { @entry << Seq.new("test", "atcg", :dna, "IIII") }
346 assert_raise(SeqError) { @entry << Seq.new("test", "atcg", :dna) }
349 test "#<< with nil qual in both entries dont raise" do
351 assert_nothing_raised { @entry << Seq.new("test", "atcg") }
354 test "#<< with qual in both entries dont raise" do
358 assert_nothing_raised { @entry << Seq.new("test", "atcg", :dna, "IIII") }
361 test "#<< without qual returns correctly" do
363 @entry << Seq.new("test", "ATCG")
364 assert_equal("atcgATCG", @entry.seq)
367 test "#<< with qual returns correctly" do
371 @entry << Seq.new("test", "ATCG", :dna, "IIII")
372 assert_equal("atcgATCG", @entry.seq)
373 assert_equal("HHHHIIII", @entry.qual)
376 test "#[] with qual returns correctly" do
377 entry = Seq.new("test", "atcg", :dna, "FGHI")
381 assert_equal("test", e.seq_name)
382 assert_equal("c", e.seq)
383 assert_equal(:dna, e.type)
384 assert_equal("H", e.qual)
385 assert_equal("atcg", entry.seq)
386 assert_equal("FGHI", entry.qual)
389 test "#[] without qual returns correctly" do
390 entry = Seq.new("test", "atcg")
394 assert_equal("test", e.seq_name)
395 assert_equal("c", e.seq)
397 assert_equal("atcg", entry.seq)
400 test "[]= with qual returns correctly" do
401 entry = Seq.new("test", "atcg", :dna, "FGHI")
403 entry[0] = Seq.new("foo", "T", :dna, "I")
405 assert_equal("test", entry.seq_name)
406 assert_equal("Ttcg", entry.seq)
407 assert_equal(:dna, entry.type)
408 assert_equal("IGHI", entry.qual)
411 test "[]= without qual returns correctly" do
412 entry = Seq.new("test", "atcg")
414 entry[0] = Seq.new("foo", "T")
416 assert_equal("test", entry.seq_name)
417 assert_equal("Ttcg", entry.seq)
420 test "#subseq with start < 0 raises" do
422 assert_raise(SeqError) { @entry.subseq(-1, 1) }
425 test "#subseq with start plus length gt seq raises" do
427 assert_raise(SeqError) { @entry.subseq(0, 5) }
430 test "#subseq returns correct sequence" do
432 assert_equal("AT", @entry.subseq(0, 2).seq)
433 assert_equal("CG", @entry.subseq(2, 2).seq)
436 test "#subseq without length returns correct sequence" do
438 assert_equal("ATCG", @entry.subseq(0).seq)
439 assert_equal("CG", @entry.subseq(2).seq)
442 test "#subseq returns correct qual" do
445 assert_equal("ab", @entry.subseq(0, 2).qual)
446 assert_equal("cd", @entry.subseq(2, 2).qual)
449 test "#subseq without length returns correct qual" do
452 assert_equal("abcd", @entry.subseq(0).qual)
453 assert_equal("cd", @entry.subseq(2).qual)
456 test "#subseq! with start < 0 raises" do
458 assert_raise(SeqError) { @entry.subseq!(-1, 1) }
461 test "#subseq! with start plus length > seq.length raises" do
463 assert_raise(SeqError) { @entry.subseq!(0, 5) }
466 test "#subseq! returns correct sequence" do
469 assert_equal("AT", @entry.seq)
472 assert_equal("CG", @entry.seq)
475 test "#subseq! without length returns correct sequence" do
478 assert_equal("ATCG", @entry.seq)
481 assert_equal("CG", @entry.seq)
484 test "#subseq! with pos and length returns correct qual" do
488 assert_equal("ab", @entry.qual)
492 assert_equal("cd", @entry.qual)
495 test "#subseq! with pos returns correct qual" do
499 assert_equal("abcd", @entry.qual)
503 assert_equal("cd", @entry.qual)
506 test "#subseq_rand returns correct sequence" do
508 assert_equal("ATCG", @entry.subseq_rand(4).seq)
511 test "#indels_remove without qual returns correctly" do
512 @entry.seq = "A-T.CG~CG"
514 assert_equal("ATCGCG", @entry.indels_remove.seq)
517 test "#indels_remove with qual returns correctly" do
518 @entry.seq = "A-T.CG~CG"
519 @entry.qual = "a@b@cd@fg"
520 assert_equal("ATCGCG", @entry.indels_remove.seq)
521 assert_equal("abcdfg", @entry.indels_remove.qual)
524 test "#composition returns correctly" do
525 @entry.seq = "AAAATTTCCG"
526 assert_equal(4, @entry.composition["A"])
527 assert_equal(3, @entry.composition["T"])
528 assert_equal(2, @entry.composition["C"])
529 assert_equal(1, @entry.composition["G"])
530 assert_equal(0, @entry.composition["X"])
533 test "#homopol_max returns 0 with empty sequence" do
535 assert_equal(0, @entry.homopol_max)
538 test "#homopol_max returns 0 with nil sequence" do
540 assert_equal(0, @entry.homopol_max)
543 test "#homopol_max returns 0 when not found" do
544 @entry.seq = "AtTcCcGggGnnNnn"
545 assert_equal(0, @entry.homopol_max(6))
548 test "#homopol_max returns correctly" do
549 @entry.seq = "AtTcCcGggGnnNnn"
550 assert_equal(5, @entry.homopol_max(3))
553 test "#hard_mask returns correctly" do
554 @entry.seq = "--AAAANn"
555 assert_equal(33.33, @entry.hard_mask)
558 test "#soft_mask returns correctly" do
559 @entry.seq = "--AAAa"
560 assert_equal(25.00, @entry.soft_mask)
563 test "#mask_seq_hard! with nil seq raises" do
567 assert_raise(SeqError) { @entry.mask_seq_hard!(20) }
570 test "#mask_seq_hard! with nil qual raises" do
574 assert_raise(SeqError) { @entry.mask_seq_hard!(20) }
577 test "#mask_seq_hard! with bad cutoff raises" do
578 assert_raise(SeqError) { @entry.mask_seq_hard!(-1) }
579 assert_raise(SeqError) { @entry.mask_seq_hard!(41) }
582 test "#mask_seq_hard! with OK cutoff dont raise" do
586 assert_nothing_raised { @entry.mask_seq_hard!(0) }
587 assert_nothing_raised { @entry.mask_seq_hard!(40) }
590 test "#mask_seq_hard! returns correctly" do
592 @entry.qual = "33456"
594 assert_equal("-NNCG", @entry.mask_seq_hard!(20).seq)
597 test "#mask_seq_soft! with nil seq raises" do
601 assert_raise(SeqError) { @entry.mask_seq_soft!(20) }
604 test "#mask_seq_soft! with nil qual raises" do
608 assert_raise(SeqError) { @entry.mask_seq_soft!(20) }
611 test "#mask_seq_soft! with bad cutoff raises" do
612 assert_raise(SeqError) { @entry.mask_seq_soft!(-1) }
613 assert_raise(SeqError) { @entry.mask_seq_soft!(41) }
616 test "#mask_seq_soft! with OK cutoff dont raise" do
620 assert_nothing_raised { @entry.mask_seq_soft!(0) }
621 assert_nothing_raised { @entry.mask_seq_soft!(40) }
624 test "#mask_seq_soft! returns correctly" do
626 @entry.qual = "33456"
628 assert_equal("-atCG", @entry.mask_seq_soft!(20).seq)
631 # qual score detection
633 test "#qual_base33? returns correctly" do
634 # self.qual.match(/[!-:]/)
635 @entry.qual = '!"#$%&\'()*+,-./0123456789:'
636 assert_equal(true, @entry.qual_base33? )
638 assert_equal(false, @entry.qual_base33? )
640 assert_equal(false, @entry.qual_base33? )
643 test "#qual_base64? returns correctly" do
644 # self.qual.match(/[K-h]/)
645 @entry.qual = 'KLMNOPQRSTUVWXYZ[\]^_`abcdefgh'
646 assert_equal(true, @entry.qual_base64? )
648 assert_equal(false, @entry.qual_base64? )
649 @entry.qual = 105.chr
650 assert_equal(false, @entry.qual_base64? )
653 test "#qual_valid? with nil qual raises" do
654 assert_raise(SeqError) { @entry.qual_valid?(:base_33) }
655 assert_raise(SeqError) { @entry.qual_valid?(:base_64) }
658 test "#qual_valid? with bad encoding raises" do
660 assert_raise(SeqError) { @entry.qual_valid?("foobar") }
663 test "#qual_valid? with OK range returns correctly" do
664 @entry.qual = ((Seq::SCORE_MIN + 33).chr .. (Seq::SCORE_MAX + 33).chr).to_a.join
665 assert_equal(true, @entry.qual_valid?(:base_33))
666 @entry.qual = ((Seq::SCORE_MIN + 64).chr .. (Seq::SCORE_MAX + 64).chr).to_a.join
667 assert_equal(true, @entry.qual_valid?(:base_64))
670 test "#qual_valid? with bad range returns correctly" do
671 @entry.qual = ((Seq::SCORE_MIN + 33 - 1).chr .. (Seq::SCORE_MAX + 33).chr).to_a.join
672 assert_equal(false, @entry.qual_valid?(:base_33))
673 @entry.qual = ((Seq::SCORE_MIN + 33).chr .. (Seq::SCORE_MAX + 33 + 1).chr).to_a.join
674 assert_equal(false, @entry.qual_valid?(:base_33))
676 @entry.qual = ((Seq::SCORE_MIN + 64 - 1).chr .. (Seq::SCORE_MAX + 64).chr).to_a.join
677 assert_equal(false, @entry.qual_valid?(:base_64))
678 @entry.qual = ((Seq::SCORE_MIN + 64).chr .. (Seq::SCORE_MAX + 64 + 1).chr).to_a.join
679 assert_equal(false, @entry.qual_valid?(:base_64))
682 # convert sanger to ...
684 test "#qual_convert! from base33 to base33 returns OK" do
685 @entry.qual = 'BCDEFGHI'
686 assert_equal('BCDEFGHI', @entry.qual_convert!(:base_33, :base_33).qual)
689 test "#qual_convert! from base33 to base64 returns OK" do
690 @entry.qual = 'BCDEFGHI'
691 assert_equal('abcdefgh', @entry.qual_convert!(:base_33, :base_64).qual)
694 test "#qual_convert! from base64 to base64 returns OK" do
695 @entry.qual = 'BCDEFGHI'
696 assert_equal('BCDEFGHI', @entry.qual_convert!(:base_64, :base_64).qual)
699 test "#qual_convert! from base64 to base33 returns OK" do
700 @entry.qual = 'abcdefgh'
701 assert_equal('BCDEFGHI', @entry.qual_convert!(:base_64, :base_33).qual)
704 test "#qual_coerce! returns correctly" do
705 @entry.qual = ('!' .. '~').to_a.join
706 assert_equal("!\"\#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII", @entry.qual_coerce!(:base_33).qual)
707 @entry.qual = ('!' .. '~').to_a.join
708 assert_equal("!\"\#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZh\\h^_`abcdefghhhhhhhhhhhhhhhhhhhhhhh", @entry.qual_coerce!(:base_64).qual)
711 test "#scores_mean without qual raises" do
713 assert_raise(SeqError) { @entry.scores_mean }
716 test "#scores_mean returns correctly" do
718 assert_equal(20.0, @entry.scores_mean)