2 $:.unshift File.join(File.dirname(__FILE__), '..', '..')
4 # Copyright (C) 2007-2011 Martin A. Hansen.
6 # This program is free software; you can redistribute it and/or
7 # modify it under the terms of the GNU General Public License
8 # as published by the Free Software Foundation; either version 2
9 # of the License, or (at your option) any later version.
11 # This program is distributed in the hope that it will be useful,
12 # but WITHOUT ANY WARRANTY; without even the implied warranty of
13 # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
14 # GNU General Public License for more details.
16 # You should have received a copy of the GNU General Public License
17 # along with this program; if not, write to the Free Software
18 # Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA.
20 # http://www.gnu.org/copyleft/gpl.html
22 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
24 # This software is part of the Biopieces framework (www.biopieces.org).
26 # >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>><<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
29 require 'maasha/locator'
33 class TestLocator < Test::Unit::TestCase
35 @seq = Seq.new(nil, "tcatgatcaagatctaacagcagaagtacacttctattta", :dna)
38 test "#new with single position returns correctly" do
39 loc = Locator.new("10", @seq)
40 assert_equal("a", loc.subseq.seq)
43 test "#new with single interval returns correctly" do
44 loc = Locator.new("5..10", @seq)
45 assert_equal("gatcaa", loc.subseq.seq)
48 test "#new with multiple intervals return correctly" do
49 loc = Locator.new("5..10,15..20", @seq)
50 assert_equal("gatcaataacag", loc.subseq.seq)
53 test "#new with join multiple intervals return correctly" do
54 loc = Locator.new("join(5..10,15..20)", @seq)
55 assert_equal("gatcaataacag", loc.subseq.seq)
58 test "#new with complement and single interval return correctly" do
59 loc = Locator.new("complement(5..10)", @seq)
60 assert_equal("ttgatc", loc.subseq.seq)